answersLogoWhite

0

When was A. Quincy Jones born?

User Avatar

Anonymous

∙ 12y ago
Updated: 8/21/2019

A. Quincy Jones was born in 1913.

User Avatar

Wiki User

∙ 12y ago
Copy

What else can I help you with?

Related Questions

When was Quincy Jones III born?

Quincy Jones III was born on December 23, 1968.


What is Quincy Jones III's birthday?

Quincy Jones III was born on December 23, 1968.


How old is Quincy Jones?

Quincy Jones is 85 years old (birthdate: March 14, 1933).


What was Quincy Jones place of birth?

Quincy Jones was born in Chicago but if ur asking for his birth hospital then i don't know


What has the author A Quincy Jones written?

A. Quincy Jones has written: 'A. Quincy Jones'


When was Quincy Jones born?

1. no he is still alive at 74 2. I know this because I'm his cousin ;p 3. lori [his niece is my aunt


What is the birth name of Quincy Jones III?

Quincy Jones III's birth name is Jones III, Quincy Delight.


Is Quincy Jones alive?

Yes. Quincy Jones is alive.


Is Quincy Jones still alive?

Yes. Quincy Jones is alive.


What actors and actresses appeared in Quincy Jones on Jazz - 1994?

The cast of Quincy Jones on Jazz - 1994 includes: Quincy Jones as himself


What actors and actresses appeared in Quincy Jones Live in Tokyo - 1981?

The cast of Quincy Jones Live in Tokyo - 1981 includes: Quincy Jones as himself


Who was Tupac girlfriend?

Kidada Jones Quincy Jones youngest daughter. Tupac Lives!!!

Trending Questions
How bad does it hurt to put ice in your hand and add salt? What sort of talks has holden had with carl in the past? What colour eyes does Mr bean have? What is the pluralistic view of svereignty.Discus its strength and weakness? How many times will 36divide into 43264? Does a 12 foot rowboat need to be registered under Michigan state law? What element has common oxidation numbers that are plus 2 and plus 3? Who is the actress in star plus anthem -tu hi tu? What or who are the cicones? Do medicine go bad after expiration date? How many people were killed by Hurricane Katrina? What can one buy from The Brick Canada online store? How can you get involved to stop gun and knife crime? Find the distance between the points: (-4, 15) and (1, 3)? How do you pronounce knute rockne's name? What is the keystroke to get windows to boot from the CD? Polaris Ranger speeds? What are the complementary bases for the following DNA strand aatggccttagcagttgcatga? Is the North Pole near Antarctica or europe? What benefits might pyloric caeca provide to fish?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.