answersLogoWhite

0

When was ARC - record company - created?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

ARC - record company - was created in 1929.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When did ARC - record company - end?

ARC - record company - ended in 1938.


When was Gallo Record Company created?

Gallo Record Company was created in 1926.


When was Jolly - record company - created?

Jolly - record company - was created in 1958.


When was Archenemy Record Company created?

Archenemy Record Company was created in 1997.


When was American Record Company created?

American Record Company was created in 1979.


When was Dick Bros Record Company created?

Dick Bros Record Company was created in 1993.


When was Dark Arc created?

Dark Arc was created in 2004.


When was Arc Innovations created?

Arc Innovations was created in 2003.


When was Sunderland Arc created?

Sunderland Arc was created in 2002.


When was The Arc of Yesod created?

The Arc of Yesod was created in 1985.


When was Arc the Lad created?

Arc the Lad was created in 1999.


When was ARC Energy created?

ARC Energy was created in 2007.

Trending Questions
What is the fractional notation for 8 over 7? What kind of animal is the ten-tailed demon beast? Would Typical form letters contain text and merge fields? Full form of hotel? Do you have garden at home? How do you tell if Chevy 350 is 5.0 or 5.7? Do all Jack Russells have webbed feet? Is the yeti friendly? What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA? What is the density of a moon rock that has a volume of 150 cubic centimeters and a mass of 350 grams? What reform was Justinian best remembered? Does any member of Cary Grant's family still live in Bristol? Does alcohol inhibit muscle growth? Why is delta seat selection unavailable? Where is the PCV valve location on a 2002 Infiniti you-35? 8 coins that equal a dollar? What has the author D Ehsan written? Tar effects on the body? Would you class Harry Potter books as monster stories? What 1995 Dustin Hoffman film was based on books hot zone and coming plague?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.