answersLogoWhite

0

When was A Rugrats Chanukah created?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

A Rugrats Chanukah was created on 1996-12-04.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

What are the release dates for Rugrats - 1991 Chanukah 4-1?

Rugrats - 1991 Chanukah 4-1 was released on: USA: 6 December 1996


When was The Chanukah Song created?

The Chanukah Song was created in 1995.


When was The Rugrats Movie created?

The Rugrats Movie was created on 1998-11-03.


When was A Rugrats Passover created?

A Rugrats Passover was created on 1995-04-13.


When was Rugrats Holiday Classics created?

Rugrats Holiday Classics was created on 2004-10-12.


When was Rugrats in Paris The Movie created?

Rugrats in Paris The Movie was created on 2000-11-07.


When was Rugrats Go Wild created?

Rugrats Go Wild was created on 2003-06-10.


When was Rugrats Pre-School Daze created?

Rugrats Pre-School Daze was created on 2005-07-24.


How do you write chanukah simcha in Hebrew?

I think you mean Chanukah same'ach (חנוכה שמח) which means "happy chanukah."But if you want Chanukah Simchah, which means "Happiness Chanukah", it is חנוכה שימחה


Where is Chanukah celebrated?

Jewish people celebrate Chanukah in their homes.


What chanukah decorations are used?

No decorations are required during Chanukah.


What do chanukah eat for Christmas?

Chanukah is a holiday. It doesn't eat.

Trending Questions
What should you do to leave merry-go-round in order not to fall down? What is the meaning of the laundry pin on a bikers jacket? What is the chemical that blocks most of the ultraviolet light from reaching earth? How many ATM of pnb in kolkata? Im almost 15 and im 5'2 most of my friends are taller than me am i under the average do you think? What are the complementary bases for the following DNA strand aatggccttagcagttgcatga? What is the last sense to leave the body when you die? How did Girl Guides begin? What was one of the archangels named in the Hebrew tradition? Why is RNA needed in a cell? Where did endless shoes come from? Why did the US intervene in the Mexican Revolution? How much did Turtle win in the Westing Game? Why did New Zealand john walker become a athlete? How willu obtain butan-2-ol from propanal? How do you get on top of Hideki tower on Skate 2 for Xbox 360? When did Samuel Tertius Galton die? Where can you buy vernors in Michigan? What is the largest nuclear charge of group 2? Does Connecticut have a football team?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.