0
What else can I help you with?
Related Questions
Does Abraham Lincoln wear a red bow tie?
No. Abraham Lincoln is dead.
Is Abraham Lincoln dead or alive?
dead
What did Abraham Lincoln do after leaving the white house?
Abraham Lincoln was the sitting President when he was shot dead.
How does Abraham Lincoln feel about America?
He's dead!
Is Abraham Leaincan still alive?
No Abraham Lincoln dead a long time ago
If Abraham Lincoln was alive today will he be happy about today's USA?
Lincoln's dead!! Get over it!
How old is Abraham Lincoln in 2015?
As of 2015, Lincoln has been dead for 150 years.
Is Abraham Lincoln the person who found Judaism?
no
Where is Abraham Lincoln's dead body?
Lincoln Tomb at Oak Ridge Cemetery in Springfield, Illinois
How much money does Abraham Lincoln make a year?
Abraham Lincoln makes roughly Zero US dollars per year because he is dead.
How old was Abraham Lincoln when dead?
He was 56 years old when he died.
Is aberham Lincoln dead?
Yes, Abraham Lincoln was shot in April, 1865 by John Wilkes Booth.
Trending Questions
Where should a seven branched menorah be placed?
Misprint you have a quarter and on the back it says Northern Mariana islands is that a misprint?
Remove the front door speaker landcruiser?
How high did sputnik go up?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
Which describes an aspect of total war as it was practiced during the Civil War?
What is the Irish Gaelic for 'fire earth metal water and wood'?
How can cactus be more useful than a rose?
What do governments do to stabilize the economy?
What are the harmul affects oxycodeine?
What is 10 percent of 650000?
Can you use frozen vegetables that have thawed?
How do you get a Disney copyright permission?
How do you round 735901 to nearest hundred thousand?
What is the 2013 murder capital?
What maths do you need to know to become an electrician?
Calculate heat of fusion?
Why some of the word use ed at the end of a word?
Can cocci bacteria be found in animals?
Timely filing limit for blue cross in Texas?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.