answersLogoWhite

0

When was André Mba Obame born?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

André Mba Obame was born in 1957.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When was Paulin Obame-Nguema born?

Paulin Obame-Nguema was born in 1934.


When was Erwin Nguéma Obame born?

Erwin Nguéma Obame was born in 1989.


When was Paula Melissa born?

Paula Melissa was born in 1976, in Santo Andr, So Paulo, Brazil.


When was Raymundo de Souza born?

Raymundo de Souza was born in Santo Andr, in So Paulo, Brazil.


When was Edith Siqueira born?

Edith Siqueira was born on September 20, 1956, in Santo Andr, So Paulo, Brazil.


When was Luiz Sacilotto born?

Luiz Sacilotto was born on April 22, 1924, in Santo Andr, So Paulo, Brazil.


When was Bruno Udovic born?

Bruno Udovic was born on March 12, 1982, in Santo Andr, So Paulo, Brazil.


When was Camila Rodrigues born?

Camila Rodrigues was born on August 23, 1983, in Santo Andr, So Paulo, Brazil.


When was Milena Toscano born?

Milena Toscano was born on January 11, 1984, in Santo Andr, So Paulo, Brazil.


When was Regiane Alves born?

Regiane Alves was born on August 31, 1978, in Santo Andr, So Paulo, Brazil.


When was Samira Alves born?

Samira Alves was born on February 24, 1981, in Santo Andr, So Paulo, Brazil.


When was Sonia Guedes born?

Sonia Guedes was born on November 22, 1932, in Santo Andr, So Paulo, Brazil.

Trending Questions
What happens to the angle of declination into the accounts when you are closer to the poles? How does cumin get spoilt? How many crew members were there in the Apollo missions? How do you tell your ex you dont like them anymore? What are some household kitchen items that do not use electrical energy? What are 3 reasons why Aristotle believe democracy was the best form of government? Where can one finds the best remortgage rates? What does you do if you crush cares about you and kida likes you as a friend but dont love you? What times what equals 5600? Is dawn Marie from WWE lesbian? Does a jacket produce heat if so what is the energy source? What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT? What did cahuilla Indians used for clothing? What is the different between audio streaming and audio downloading? What does the phrase it is difficult to produce a clapping sound with one hand mean? When were kettles first used? What is difference between sulphides and sulphates? What is the important about the delta? Are human vampire's real? Was the Golden Dawn good or evil?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.