answersLogoWhite

0

When was Ann Wehrer born?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Ann Wehrer was born in 1929.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When did Ann Wehrer die?

Ann Wehrer died on March 22, 2007.


When was Antoine Wehrer born?

Antoine Wehrer was born in 1890.


When was Ann Moura born?

Ann Moura was born in 1947.


When was Ann Charters born?

Ann Charters was born in 1936.


When was Ann Macbeth born?

Ann Macbeth was born in 1875.


When was Ann Lambert born?

Ann Lambert was born in 1957.


When was Ann Waldron born?

Ann Waldron was born in 1924.


When was Ann Leonard born?

Ann Leonard was born in 1969.


When was Ann Lauterbach born?

Ann Lauterbach was born in 1942.


When was Ann Cleeves born?

Ann Cleeves was born in 1954.


When was Ann Atwater born?

Ann Atwater was born in 1935.


When was Sim Ann born?

Sim Ann was born in 1975.

Trending Questions
What is the difference between a turkey and a chicken? Why don't you get a shock if you touch the plastic covering of an electric wire? If the digits of your present age are reversed then you get the age of your son if 1 year ago your age was twice as that of your son find my present age? Are soods Punjabi? What is vss on Lincoln continental on 1997? What are the Yearly Rainfall amounts in Salem Pendleton Eugene Redmond Medford and Lakeview Oregon? What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA? How can you make a Mazda miata fast? What best explains why points cannot have a diameter of 0.5 mm? What continents connected during the ice age? Is all jack Daniels made in Tennessee? What is a similarity between a plant root hair cell and an animal small intestine cell? What is the reaction for Ag plus O2 AgO? What is the correct method of stopping in in-line skates? What are some team mascots that begin with the letter T? Anu anu ang bansang nasakop ng France? Funnel clouds in a vision or dream? How to die without hurting yourself? When did Mount Ruapehu last erupt? What is specialized agriculture?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.