0
What else can I help you with?
Related Questions
When was Anna Eriksdotter - Bielke - born?
Anna Eriksdotter - Bielke - was born in 1490.
When did Anna Eriksdotter die?
Anna Eriksdotter died in 1704.
When did Anna Eriksdotter - Bielke - die?
Anna Eriksdotter - Bielke - died in 1525.
When was Virginia Eriksdotter born?
Virginia Eriksdotter was born in 1559.
When was Margareta Eriksdotter Vasa born?
Margareta Eriksdotter Vasa was born in 1497.
When was Kerstin Eriksdotter born?
Kerstin Eriksdotter was born on November 19, 1943, in lvdalen, Dalarnas ln, Sweden.
What is the birth name of Kerstin Eriksdotter?
Kerstin Eriksdotter's birth name is Kerstin Elisabeth Eriksdotter.
When did Ragnhild Eriksdotter die?
Ragnhild Eriksdotter died in 984.
When did Virginia Eriksdotter die?
Virginia Eriksdotter died in 1633.
When did Barbro Eriksdotter - Bielke - die?
Barbro Eriksdotter - Bielke - died in 1553.
When did Margareta Eriksdotter Vasa die?
Margareta Eriksdotter Vasa died in 1536.
When was Anna Bjorn born?
Anna Bjorn was born in 1955, in Iceland.
Trending Questions
How do you test 4 wire PT100 temperature sensor RDT?
How many amendments in South Carolina's constitution?
What are the three most important gods in Hinduism?
How long is the flight from Melbourne Australia to the Caribbean?
What is 4.28 to the nearest tenths?
Can you drink energy drinks with lisinopril?
How much should i charge to paint a mailbox?
How are hydrographs useful to hydrologists?
Once a sedative and cure for nervous tension the ion of this element is now a trite or commonplace expression?
how can i make 10 using nine 9s?
What is Honduras coin?
What is the difference between Romanticism and Naturalism?
What time of year did the thylacine breed?
What is the balanced chemical equation of HCl and C6H8O7 Citric Acid?
Where is the heater control valve located on your 1994 e 150 van?
What is the meaning of 'virsa' in Punjabi language?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
Where does Ariana Grande get her purple giraffe?
What is the classification of a triangle with sides of length 5 inches 12 inches and 13 inches?
What is the subscript of sodium chloride?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.