0
What else can I help you with?
Related Questions
When did Anna Rogstad die?
Anna Rogstad died in 1938.
When was Solveig Rogstad born?
Solveig Rogstad was born in 1982.
When was Anker Rogstad born?
Anker Rogstad was born on 1925-01-08.
When did Anker Rogstad die?
Anker Rogstad died on 1994-10-05.
When was Anna Bjorn born?
Anna Bjorn was born in 1955, in Iceland.
When was Anna Riva born?
Anna Maria Rizzoli was born in 1953.
When was Anna Koutsoyiannis born?
Anna Koutsoyiannis was born in 1932.
When was Anna Sterky born?
Anna Sterky was born in 1856.
When was Anna Nitschmann born?
Anna Nitschmann was born in 1715.
When was Anna Kravtchenko born?
Anna Kravtchenko was born in 1976.
When was Anna Demidova born?
Anna Demidova was born in 1878.
When was Anna Melikian born?
Anna Melikian was born in 1976.
Trending Questions
What is the difference between a white wizard and a grey wizard?
What is a cantus?
How long should there be light for a fresh water tank?
Who is jimmy studebaker?
On a balance sheet what does members' deficit mean?
What is a fabrica dearmas oviedo 1931 worth?
What does cephalic means in ultrasound?
Words that start with the letter g and end with the letter R?
What is the song from the Glee commercial lyrics are I'm ready now or something like that?
When was greek salad invented?
Why would you expect a dead zone to start near the mouth of a river where the river flows into a body of water?
What are euro notes made of?
What is the definition of the word geo?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
You just burned your finger on a pan that just came out of a 400 degree oven what should you do?
What was the name of Joey's soap opera?
What nationality is the surname Goike?
What is the connotation of the word prim?
Kasukdulan parte ng sa pula sa puti ni francisco rodrigo?
Who wrote the poem street music?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.