answersLogoWhite

0

When was Assembly of Turkmenistan created?

User Avatar

Anonymous

∙ 12y ago
Updated: 8/21/2019

Assembly of Turkmenistan was created in 1938.

User Avatar

Wiki User

∙ 12y ago
Copy

What else can I help you with?

Related Questions

When was Turkmenistan Airlines created?

Turkmenistan Airlines was created in 1992.


When was Turkmenistan created?

Turkmenistan was created on 1991-10-27.


When was Military of Turkmenistan created?

Military of Turkmenistan was created in 1992.


When was Turkmenistan manat created?

Turkmenistan manat was created in 1993.


When was Turkmenistan Cup created?

Turkmenistan Cup was created in 1993.


When was Football Association of Turkmenistan created?

Football Association of Turkmenistan was created in 1992.


When was Communist Party of Turkmenistan created?

Communist Party of Turkmenistan was created in 1921.


When was The main museum of Turkmenistan created?

The main museum of Turkmenistan was created in 1998.


When was Democratic Party of Turkmenistan created?

Democratic Party of Turkmenistan was created in 1991.


When was Red Crescent Society of Turkmenistan created?

Red Crescent Society of Turkmenistan was created in 1926.


When was National Olympic Committee of Turkmenistan created?

National Olympic Committee of Turkmenistan was created in 1990.


When was Turkmenistan National Space Agency created?

Turkmenistan National Space Agency was created in 2011.

Trending Questions
When the is mature the sporangium opens? What is the collective noun for ministers? What is top speed of 2005 Chrysler 300C 5.7 liter engine? Was seth Egyptian god seth alive during 3500bc to 3790bc? Will the g52 trans out of 84 Toyota 4wd pickup swap out with w56 trans in 89 Toyota truck 4wd both 4-cylinder? How does fabric affect parachute hangtime? Comparison between general purpose application software and function-specific application function? Why did they cancel Danny Phantom? What size does Ford make wheels in? How do you write 9.21MILLION in number? What is an example of a weak declension? What fraction is divided by 6 to equal 12? What is the relationship between a computer's CPU speed CPU cache and it's main bus speed with regard to the computer's performance? What times what equals -1500 but when added together equals -340? How many promises are in the King James Bible? What is state of being different or unique is? What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT? What does sanding sugar do in sugar cookies? What illness caused perry mason to use a wheel chair? What Middle Eastern country has a sword in its flag?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.