answersLogoWhite

0

When was Bert Tulloch born?

User Avatar

Anonymous

∙ 12y ago
Updated: 8/21/2019

Bert Tulloch was born on 1889-02-23.

User Avatar

Wiki User

∙ 12y ago
Copy

What else can I help you with?

Related Questions

When did Bert Tulloch die?

Bert Tulloch died on 1953-02-15.


When was William Tulloch born?

William Tulloch was born in 140#.


When was John Tulloch born?

John Tulloch was born in 1823.


When was Alexander Tulloch born?

Alexander Tulloch was born in 1803.


When was Kenute Tulloch born?

Kenute Tulloch was born in 1965.


When was Lee Tulloch born?

Lee Tulloch was born in 1954.


When was Bobby Tulloch born?

Bobby Tulloch was born in 1929.


When was Geoffrey Tulloch born?

Geoffrey Tulloch was born in 1929.


When was Lardie Tulloch born?

Lardie Tulloch was born on 1871-04-15.


When was Stephen Tulloch born?

Stephen Tulloch was born on 1985-01-01.


When was Bitsie Tulloch born?

Bitsie Tulloch was born on January 19, 1981, in USA.


When was John Walter Graham Tulloch born?

John Walter Graham Tulloch was born in 1861.

Trending Questions
When the is mature the sporangium opens? What is the collective noun for ministers? What is top speed of 2005 Chrysler 300C 5.7 liter engine? Was seth Egyptian god seth alive during 3500bc to 3790bc? Will the g52 trans out of 84 Toyota 4wd pickup swap out with w56 trans in 89 Toyota truck 4wd both 4-cylinder? How does fabric affect parachute hangtime? Comparison between general purpose application software and function-specific application function? Why did they cancel Danny Phantom? What size does Ford make wheels in? How do you write 9.21MILLION in number? What is an example of a weak declension? What fraction is divided by 6 to equal 12? What is the relationship between a computer's CPU speed CPU cache and it's main bus speed with regard to the computer's performance? What times what equals -1500 but when added together equals -340? How many promises are in the King James Bible? What is state of being different or unique is? What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT? What does sanding sugar do in sugar cookies? What illness caused perry mason to use a wheel chair? What Middle Eastern country has a sword in its flag?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.