0
Carissa Becker was born on July 27, 1985, in Riverside, California, USA.
What else can I help you with?
Related Questions
What is the birth name of Carissa Becker?
Carissa Becker's birth name is Carissa Marie Becker.
How tall is Carissa Becker?
Carissa Becker is 5' 1".
When was Carissa Blix born?
Carissa Blix was born in 1960.
When was Niccolò Carissa born?
Niccolò Carissa was born in 1730.
When was Carissa Moore born?
Carissa Moore was born on 1992-08-27.
When was Carissa Putri born?
Carissa Putri was born on September 12, 1984, in Frankfurt, Germany.
When was Carissa Casula born?
Carissa Casula was born on June 12, 1986, in Illinois, USA.
When was Carissa Weir born?
Carissa Weir was born on January 24, 1975, in Port Antonio, Jamaica.
When was Carissa Potenza born?
Carissa Potenza was born on October 5, 1976, in Indianapolis, Indiana, USA.
When was Carissa Capobianco born?
Carissa Capobianco was born on July 5, 1988, in Atlanta, Georgia, USA.
When was Carissa Channing born?
Carissa Channing was born on November 7, 1963, in Hollywood, California, USA.
When was Carissa Hernandez born?
Carissa Hernandez was born on January 31, 1979, in San Antonio, Texas, USA.
Trending Questions
What is Harry Styles from one direction favorite football team?
Is Utah Nevada Idaho and Western Colorado are all part of the Western Frontier?
What is the ratio for a visage from King Black Dragon?
How old where people when they joined world war 2?
How much should a 4'6 8 year old boy weigh?
What does the word mean having to do with community worship?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
What are codes called when procedures are grouped together?
When was Charles S. Kaelin born?
What is the law in Texas about children riding in the front seat of a vehicle?
What happened to miners and towns when the gold ran out?
Do organelles use energy from sunlight to produce food are called mitochondria?
What are five methods of nomination used today include?
How much work will be needed to lift a block weighin 4 newtons and a distance of 10 meters?
How old do you have to be to get a tattoo in Missouri if you already have one?
Have Holly Willoughby and Stephen Mulhern ever dated?
What tectonic plates does the eyjafjallajokull sit on?
How much transmission fluid do you need to change in a 1991 Toyota Land Cruiser?
What historical events happened in 1933?
What are the 5 odd numbers whose sum is 50 from 1 to 49?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.