answersLogoWhite

0

When was Carl-Erik Asplund born?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Carl-Erik Asplund was born in 1923.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When was Arne Asplund born?

Arne Asplund was born in 1903.


When was Lena Asplund born?

Lena Asplund was born in 1956.


When was Johan Asplund born?

Johan Asplund was born in 1937.


When was Lillian Asplund born?

Lillian Asplund was born on October 21, 1906.


When was Gunnar Asplund born?

Gunnar Asplund was born on September 22, 1885.


What is Lillian Asplund's birthday?

Lillian Asplund was born on October 21, 1906.


What is Gunnar Asplund's birthday?

Gunnar Asplund was born on September 22, 1885.


When was Folke Asplund born?

Folke Asplund was born on August 20, 1930, in Malmberget, Norrbottens ln, Sweden.


When was Magnus Asplund born?

Magnus Asplund was born on April 1, 1977, in Sderhamn, Gvleborgs ln, Sweden.


What is the birth name of Folke Asplund?

Folke Asplund's birth name is Erik Folke Asplund.


What is the birth name of Josefin Asplund?

Josefin Asplund's birth name is Maria Josefin Asplund.


How old is Gunnar Asplund?

Gunnar Asplund was born on September 22, 1885 and died on October 20, 1940. Gunnar Asplund would have been 55 years old at the time of death or 129 years old today.

Trending Questions
Why should grizzly bears stay in zoos? Is a person's deceased step-mother's deceased brother's living spouse any relation to them or their father at all? How long is flight time from Las Vegas to Houston? Who plays the boy Miley Cyrus likes in her new movie? Where is the syllable break in the word behind? What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT? A word that starts with the letter i in french? What if a auto parts stroe gives a discount to 14 of every 100 shoppers. what percent of the shoppers receive a discount? Why 24 carat gold is not suitable for making jewelry? When did Alessandro Momo die? Is Janice Dickinson a lesbian? How can you get two accounts on Horseisle with the same internet connection? Why do some people have to pee more often than others? Covert 5 foot 2 to meters? What is the past tense of glad? Can moringa seed be used to cure fibroid? The sum of eight times a number and seven is twice the number? What is the main difference of Bunsen burner to alcohol lamp? What is the literacy rate of Dubai? How did blind fury go blind?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.