0
Chuck Vail was born on July 9, 1974, in Tupelo, Mississippi, USA.
What else can I help you with?
Related Questions
How tall is Chuck Vail?
Chuck Vail is 6' 2".
When was Aaron Vail born?
Aaron Vail was born in 1796.
When was Rachel Vail born?
Rachel Vail was born in 1966.
When was Peter Vail born?
Peter Vail was born in 1930.
When was Benjamin A. Vail born?
Benjamin A. Vail was born in 1844.
When was Eric Vail born?
Eric Vail was born on September 16, 1953.
When was Tobi Vail born?
Tobi Vail was born on July 20, 1969.
When was Vail Bloom born?
Vail Bloom was born in Boston, in Massachusetts, USA.
When was Melville Vail born?
Melville Vail was born on 1906-07-05.
When was Thomas Hubbard Vail born?
Thomas Hubbard Vail was born in 1821.
When was George Vail born?
George Vail was born on 1809-07-21.
When was Richard B. Vail born?
Richard B. Vail was born in 1895.
Trending Questions
How do you replace the EGR on a Chevy Tracker?
How do you install intagram?
What was the name of James Watt's father?
Which of the foefollowing not considered an antigen-presenting cell?
Who was the first deputy marshall on Gunsmoke?
Egg's functions and its neutrients?
Describe the search for peace in the 1920s and its results?
What is the measure of an exterior angle of a 25 sided polygon?
Is 3km longer than 2900m?
Who is on of the Texas state's us Senators now?
What is hackensack?
What is the circumference of a circle with a diameter of 5m in terms of pi?
Who developed the Hangul writing system?
What is systalic and diastalic?
Is one half large than one frouth?
What is 9 divied by 3593?
How much money is 14k gold worth?
What is a common obstacle that keep soldiers from receiving mental health assistance?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
What is the definition of low sugar?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.