answersLogoWhite

0

When was College of Visual Arts created?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

College of Visual Arts was created in 1948.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When was School of Visual Arts created?

School of Visual Arts was created in 1947.


When was Sainsbury Centre for Visual Arts created?

Sainsbury Centre for Visual Arts was created in 1978.


When was Dayton Visual Arts Center created?

Dayton Visual Arts Center was created in 1991.


When was Carpenter Center for the Visual Arts created?

Carpenter Center for the Visual Arts was created in 1962.


When was Richmond Center for Visual Arts created?

Richmond Center for Visual Arts was created in 2007.


When was Yukon School of Visual Arts created?

Yukon School of Visual Arts was created in 2007.


When was first Center for the Visual Arts created?

Frist Center for the Visual Arts was created in 1932.


When was Temptation of Saint Anthony in visual arts created?

Temptation of Saint Anthony in visual arts was created in 1505.


When was Bronx High School for the Visual Arts created?

Bronx High School for the Visual Arts was created in 2002.


When was Jonas Mekas Visual Arts Center created?

Jonas Mekas Visual Arts Center was created in 2007.


Arts colleges is a colleges that emerges from arts?

An art college focuses on all of the arts visual and instrumental


When was Augusta Fells Savage Institute of Visual Arts created?

Augusta Fells Savage Institute of Visual Arts was created in 2004.

Trending Questions
What are the organs located in hypogastric region? Which A-level subjects do I need to take if I am are persuing a degree in mass communication? What country invaded Korea in 1592? What is 21 degrees and 21 mins north and 157 degrees and 57 mins west? A White Computer Desk Can Be Calming? What gang has a burgundy flag? How do you say thank you so much in chuukese? How do you round 58.635 to the nearest hundredth? Can lifting weights cause constipation? What are the differences between responses of mammals and flowering plants? What is the area of the excel window in which you enter and edit data? Did descartes believe in the very powerful evil demon? Where do you get a diamond armlet? How far is it from Greenville SC to Cocoa Beach FL? What is an graphical operating system? What is a fem agress? Can a self cleaning oven be stopped before it's done? What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA? What did Joe Frazier do? What rhymes with calories?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.