0
What else can I help you with?
Related Questions
When was David Shulman born?
David Shulman died in 2004.
When was Andrew Shulman born?
Andrew Shulman was born in 1960.
When was Lawrence Shulman born?
Lawrence Shulman was born in 1937.
When was Phil Shulman born?
Phil Shulman was born in 1937.
When was Paul Shulman born?
Paul Shulman was born in 1922.
When was Max Shulman born?
Max Shulman was born in 1919.
When was Zinovii Shulman born?
Zinovii Shulman was born in 1924.
When was Dennis Shulman born?
Dennis Shulman was born in 1950.
When was Douglas Shulman born?
Douglas Shulman was born in 1967.
When was Alan Shulman born?
Alan Shulman was born in 1915.
When was Eliezer Shulman born?
Eliezer Shulman was born in 1923.
When was Ray Shulman born?
Ray Shulman was born on December 8, 1949.
Trending Questions
When the is mature the sporangium opens?
What is the collective noun for ministers?
What is top speed of 2005 Chrysler 300C 5.7 liter engine?
Was seth Egyptian god seth alive during 3500bc to 3790bc?
Will the g52 trans out of 84 Toyota 4wd pickup swap out with w56 trans in 89 Toyota truck 4wd both 4-cylinder?
How does fabric affect parachute hangtime?
Comparison between general purpose application software and function-specific application function?
Why did they cancel Danny Phantom?
What size does Ford make wheels in?
How do you write 9.21MILLION in number?
What is an example of a weak declension?
What fraction is divided by 6 to equal 12?
What is the relationship between a computer's CPU speed CPU cache and it's main bus speed with regard to the computer's performance?
What times what equals -1500 but when added together equals -340?
How many promises are in the King James Bible?
What is state of being different or unique is?
What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT?
What does sanding sugar do in sugar cookies?
What illness caused perry mason to use a wheel chair?
What Middle Eastern country has a sword in its flag?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.