answersLogoWhite

0

When was Darya Belousova born?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Darya Belousova was born on August 29, 1983, in USSR.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

What is the birth name of Darya Belousova?

Darya Belousova's birth name is Darya Vladimirovna Belousova.


When was Irina Belousova born?

Irina Belousova was born in 1954.


When was Ludmila Belousova born?

Ludmila Belousova was born on 1935-11-22.


When was Tinatin Belousova born?

Tinatin Belousova was born on October 16, 1937, in Yerevan, Armenia.


What movie and television projects has Darya Belousova been in?

Darya Belousova has: Performed in "Povesti Belkina. Grobovshchik" in 1991. Played Sveta in "Moy svodnyy brat Frankenshteyn" in 2004. Performed in "Delo o myortvykh dushakh" in 2005. Performed in "Ivan Podushkin. Dzhentlmen syska" in 2006. Played Katya in "Ottsy i deti" in 2008. Played Oksana (2008) in "Provintsialka" in 2008. Performed in "Chempion" in 2008.


When was Darya Dontsova born?

Darya Dontsova was born in 1952.


When was Darya Pchelnik born?

Darya Pchelnik was born in 1981.


When was Darya Ekamasova born?

Darya Ekamasova was born on May 20, 1984.


When was Darya Kalmykova born?

Darya Kalmykova was born on March 4, 1983.


When was Darya Poverennova born?

Darya Poverennova was born on 1972-06-15.


When was Darya Domracheva born?

Darya Domracheva was born on 1986-08-03.


When was Darya Melnikova born?

Darya Melnikova was born on 1992-02-09.

Trending Questions
What layer of the earth that Metal of this region are squeezed tight due to great pressure? What term describe people leaving farm to live and work in city? What is surface complexation? Who were melchior and casper? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? How many 150 ml glasses in 4 litres of water? Can you provide examples of IOUs and explain how they are typically used in financial transactions? What was the most powerful ancient country? What happens at the end of the book Scat? What is the quotient of 4 and 82? What are the most effective exercises to target the abs using an exercise ball? Where did the plague begin and how was the plague spread from place to place? Did Bruce Lee fight a demon? How tall is Nunziatina Vitanza? Does sterling knight kissed Selena Gomez? What actors and actresses appeared in Obake no Q-taro - 1965? How can you remove scale floating around and blocking your faucets? Which is true about the effect farming has on erosion? When was Grant Ibbs born? What not to mix with anitripyline?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.