0
What else can I help you with?
Related Questions
When was Eliyahu Golomb born?
Eliyahu Golomb was born in 1893.
When was Michael Golomb born?
Michael Golomb was born in 1909.
When was Cazzy Golomb born?
Cazzy Golomb was born in Honolulu, in Hawaii, USA.
When was Iosif Golomb born?
Iosif Golomb was born on October 16, 1920.
When was Vitaly M. Golomb born?
Vitaly M. Golomb was born in 1981.
When was Solomon W. Golomb born?
Solomon W. Golomb was born on 1932-05-30.
When was Tal Golomb born?
Tal Golomb was born on March 21, 1976, in Columbus, Ohio, USA.
What is the birth name of Iosif Golomb?
Iosif Golomb's birth name is Iosif Emmanuilovich Golomb.
What is the birth name of Tal Golomb?
Tal Golomb's birth name is Golomb, Tal Jacob.
How tall is Cazzy Golomb?
Cazzy Golomb is 5' 4".
How tall is Tal Golomb?
Tal Golomb is 5' 11".
When did Eliyahu Golomb die?
Eliyahu Golomb died in 1945.
Trending Questions
When the is mature the sporangium opens?
What is the collective noun for ministers?
What is top speed of 2005 Chrysler 300C 5.7 liter engine?
Was seth Egyptian god seth alive during 3500bc to 3790bc?
Will the g52 trans out of 84 Toyota 4wd pickup swap out with w56 trans in 89 Toyota truck 4wd both 4-cylinder?
How does fabric affect parachute hangtime?
Comparison between general purpose application software and function-specific application function?
Why did they cancel Danny Phantom?
What size does Ford make wheels in?
How do you write 9.21MILLION in number?
What is an example of a weak declension?
What fraction is divided by 6 to equal 12?
What is the relationship between a computer's CPU speed CPU cache and it's main bus speed with regard to the computer's performance?
What times what equals -1500 but when added together equals -340?
How many promises are in the King James Bible?
What is state of being different or unique is?
What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT?
What does sanding sugar do in sugar cookies?
What illness caused perry mason to use a wheel chair?
What Middle Eastern country has a sword in its flag?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.