answersLogoWhite

0

When was David I. Rozenberg born?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

David I. Rozenberg was born in 1879.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When did David I. Rozenberg die?

David I. Rozenberg died in 1950.


When was Grzegorz Rozenberg born?

Grzegorz Rozenberg was born in 1942.


When was Pavlo Rozenberg born?

Pavlo Rozenberg was born in 1983.


When was Yekaterina Rozenberg born?

Yekaterina Rozenberg was born in 1980.


When was Joshua Rozenberg born?

Joshua Rozenberg was born on May 30, 1950, in Hammersmith, London, England, UK.


When was Lucien Rozenberg born?

Lucien Rozenberg was born on June 11, 1874, in Paris, France.


What is the birth name of Joshua Rozenberg?

Joshua Rozenberg's birth name is Joshua Rufus Rozenberg.


When did Lucien Rozenberg die?

Lucien Rozenberg died in 1947, in France.


What has the author Guillaume Rozenberg written?

Guillaume Rozenberg has written: 'Renoncement et puissance'


What has the author Danielle Rozenberg written?

Danielle Rozenberg has written: 'L' Espagne contemporaine et la question juive'


What has the author Lazar' Davydovich Rozenberg written?

Lazar' Davydovich Rozenberg has written: 'Fizika i tekhnika moshchnogo ul'trazvuka' -- subject(s): Ultrasonic waves


What has the author Paul Rozenberg written?

Paul Rozenberg has written: 'Le romantisme anglais' -- subject(s): English literature, Romanticism, History and criticism

Trending Questions
How many miles between Scottsboro Alabama and Baton Rouge Louisiana? What is the mRNA strand for ggctatatcctgcgctatacgcta? What is a thin strand of hair called? How many extinct animals are there right now in the world? How do you download Vista drivers for a H P printer? How many countries were effected by world war 1? Why is it important to mind your own business? What does the father begets the son mean? What does PAP look like? Why is the chicken drumstick indigestible for old lady? What fraction correctly represents 0.63? What are the standard dimensions of a home door? What is the name of Paul McCartney's sheepdog? How many years in a sesquicentenary? What is a icd 9 code for ESR? How do you build gondola the base mysims kingdom? Why does buttermilk look kind of like yogurt? What type of polynomial is shown below 7x2-3x plus 4? Can you give an example of a response to a welcome speech for church? How many northern pikes are caught a year in Minnesota?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.