answersLogoWhite

0

When was Dennis Wheatley born?

User Avatar

APIBirthday ∙

Lvl 1
∙ 16y ago
Updated: 8/18/2019

Dennis Wheatley was born on January 8, 1897.

User Avatar

Wiki User

∙ 16y ago
Copy

What else can I help you with?

Related Questions

When did Dennis Wheatley die?

Dennis Wheatley was born on January 8, 1897.


How old was Dennis Wheatley at death?

Dennis Wheatley died at the age of 80 on November 10, 1977.


How old is Dennis Wheatley?

Dennis Wheatley was born on January 8, 1897 and died on November 10, 1977. This would have been 80 years old at the time of death or 113 years old today.


What are the ratings and certificates for Dennis Wheatley at Hammer - 2012 V?

Dennis Wheatley at Hammer - 2012 V is rated/received certificates of: UK:15


How old is wheatley?

Dennis Wheatley was born on January 8, 1897 and died on November 10, 1977. This would have been 80 years old at the time of death or 113 years old today.


What actors and actresses appeared in Dennis Wheatley at Hammer - 2012?

The cast of Dennis Wheatley at Hammer - 2012 includes: Marcus Hearn as Himself - Hammer Films Historian Jonathan Rigby as Himself - author


When was Mervyn Wheatley born?

Mervyn Wheatley was born in 1880.


When was Bill Wheatley born?

Bill Wheatley was born in 1909.


When was Justin Wheatley born?

Justin Wheatley was born in 1964.


When was Keith Wheatley born?

Keith Wheatley was born in 1946.


When was John Wheatley born?

John Wheatley was born in 1869.


When was Ben Wheatley born?

Ben Wheatley was born in 1972.

Trending Questions
What has the author Caitlin Moran written? If every time you get mad and you cry Is this considered depression? What is a deficiency in the irr? What is the meaning of advencher? What did the US government accomplish under the articles of confederation? What is an example of a saddle joint in a human? Which province province voted to remain in Canada in 1995? Who will be returning to Doctor Who for series 4? How do you mount a bike properly? Why is the accounting entity concept so fundamental that it pervades all of accounting? How do dissolved oxygen meters work? Why was the iron age called the iron? Who sells iPod nano cases? What is code p1768 for 99 dodge caravan? What has happened in the governments of all of Central American countries since they own their freedom from Spain? What machine generates the mercalli scale? Where is Samarpur hill station? What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg? Can a Ethernet tranceiver be used to adapt a phone the the internet? What type of epithelial tissue forms the dermis of the skin?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.