answersLogoWhite

0

When was Elana Meyers born?

User Avatar

Anonymous

∙ 13y ago
Updated: 9/17/2019

Elana Meyer was born in 1966.

User Avatar

Wiki User

∙ 12y ago
Copy

What else can I help you with?

Related Questions

Who is in Elana Meyers family?

Elana Meyers, American bobsledder, has two siblings, Erica and Elise Meyers. Her parents are Eddie and Janet Meyers.


When was Elana Wills born?

Elana Wills was born in 1962.


When was Elana Hill born?

Elana Hill was born in 1988.


When was Elana James born?

Elana James was born in 1970.


When was Elana Dykewomon born?

Elana Dykewomon was born in 1949.


What high school did elana Meyers atened?

Lithia Springs High school in Douglas County, Georgia


When was Elana Schreiner born?

Elana Schreiner was born on November 6, 1936.


When was Elana Binysh born?

Elana Binysh was born on July 27, 1993, in England, UK.


When was Elana Dunkelman born?

Elana Dunkelman was born on July 11, 1986, in Montreal, Canada.


When was Elana Safar born?

Elana Safar was born on February 26, 1985, in New Jersey, USA.


When was Elana Shilling born?

Elana Shilling was born on June 15, 1990, in Thornhill, Ontario, Canada.


When was Elana Eden born?

Elana Eden was born on May 1, 1940, in Bat Yam, Israel.

Trending Questions
Did frank Sinatra smoke? How tall is 151 cm in feet? What is the Italian translation of 'to stay safe'? What states have a town named Trenton? What is the correct complementary DNA starnd for gacatcgttgactacggctgatc? What does it mean if someone says it smells like a balls? How old is Scrooge when he worked for Fezziwig? What is the name of a famous trombonist? What are measurements of hulk hogan's biceps? How long does it take to fly between Vancouver BC and Saudia Arabia? What are the coefficient in 3Mg N2 - Mg3N2? How did George Washington feel about his hometown or country? How long earth take to revolve around sun? Does Sydney have a nuclear power station? What is RESH in metar? Where is the exact location of registry of deeds in taguig? How does a musher control his sled team? What is electromagnetic printers? What are two virtues that Thomas Garrett and Harriet Tubman have in common? Who is Mr.Guillaume and he was the prime minister of Haiti before Evans Paul?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.