0
What else can I help you with?
Related Questions
When was Francisco de Paula Andrade Troconis born?
Francisco de Paula Andrade Troconis was born in 1840.
When was Francisco Everton de Almeida Andrade born?
Francisco Everton de Almeida Andrade was born on 1984-08-08.
When was Francisco Gomez de Andrade Junior born?
Francisco Gomes de Andrade Junior was born on 1980-03-13.
When was Francisco Rebelo de Andrade born?
Francisco Rebelo de Andrade was born on April 28, 1980, in Lisbon, Portugal.
When did Francisco de Paula Andrade Troconis die?
Francisco de Paula Andrade Troconis died in 1915.
When was Francisco Andrade Marín born?
Francisco Andrade Marín was born in 1841.
What is the birth name of Chico de Andrade?
Chico de Andrade's birth name is Francisco Ramos de Andrade Neto.
When was Gil de Andrade born?
Gil de Andrade was born in 1883.
When was Haroldo de Andrade born?
Haroldo de Andrade was born in 1934.
When was Castor de Andrade born?
Castor de Andrade was born in 1926.
When was Valeria De Andrade born?
Valeria De Andrade was born in Brazil.
When was Oswald de Andrade born?
Oswald de Andrade was born on January 11, 1890.
Trending Questions
What is used to create a large sample of DNA for testing for a small sample of DNA?
How can you say alacrity?
How many miles is Dallas Texas from Monterrey Mexico?
Where is power steering reservoir located on 1997 Buick 3800 V6?
Do sharks migrate or hibernate?
How many HP does the durmite have in Mario and Luigi?
What spice is made from peppers 7 letters?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
How can I effectively use spray paint to transform my furniture?
When did Battle of Johnsonville happen?
Is The Program Manager recommends and appoints the Contracting Officers Representative in writing?
How can you destroy floppy disk information before disposing of them?
What is a periodic reversal of the pattern of mid-pacific ocean currents?
What does it take to be an archetect?
When does 1.2 come out for terraria on andriod?
How do you replace the power network box megafuse?
What is a default name for a new table in an access database?
A fourteen line poem written in iambic pentameter with the rhyme scheme abab bcbc cdcd ee is known as what?
When did pigs start flying?
Why are hardcover books so expensive compared to other formats?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.