0
What else can I help you with?
Related Questions
When did George Vandeleur Fiddes die?
George Vandeleur Fiddes died in 1936.
When was Frank Fiddes born?
Frank Fiddes was born in 1906.
When was Richard Fiddes born?
Richard Fiddes was born in 1671.
When was Iris Vandeleur born?
Iris Vandeleur was born in 1901.
When was Giles Vandeleur born?
Giles Vandeleur was born in 1911.
When was Paul Fiddes born?
Paul Fiddes was born on 1947-04-30.
When did Giles Vandeleur die?
Giles Vandeleur died in 1978.
What has the author Richard Fiddes written?
Richard Fiddes has written: 'The doctrine of a future state, and that of the soul's immortality, asserted and distinctly proved'
What has the author Victor H Fiddes written?
Victor H. Fiddes has written: 'Revelation - with or without assistance?' 'Science andthe Gospel' -- subject(s): Religion and science
What has the author Victor Fiddes written?
Victor Fiddes has written: 'The architectural requirements of Protestant worship' -- subject(s): Church architecture, Designs and plans, Protestant church buildings
Who is stapletons father in the hound of the baskervilles?
Mr vandeleur
What is the birth name of Bruce Houlder?
Bruce Houlder's birth name is Bruce Fiddes Houlders.
Trending Questions
How much is a bauer.25 caliber worth?
Is kilometers per hour officially abbreviated KPH or KMH or are both ways accepted?
What is the major conflict in The View From Saturday?
Who was the colored free produce society of Pennsylvania?
How many 8 oz glasses in pint?
You are 82 years old and have a heartbeat of 58 per minute?
What is the fifth largest continent?
Is japan a free country and do they have a free elections?
How old is Susan Saint James?
How does daycare work in soul silver?
Is maple syrup from Northeast?
In medical terms what is the 'Christmas factor'?
Is suriname a colony?
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
What is the orbital distance of a average satellite?
What does rotten sirloin look like?
When managing people you should avoid?
When was kapiolani Maternity built?
Did Alexander Graham Bell invent the word hello?
What is a baby dragon?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.