0
George Washington Toland was born in 1796.
What else can I help you with?
Related Questions
When did George Washington Toland die?
George Washington Toland died in 1869.
When was Christopher Toland born?
Christopher Toland was born in 1985.
When was John Toland born?
John Toland was born on November 30, 1670.
When was John Toland - wrestler - born?
John Toland - wrestler - was born on 1980-08-31.
What is John Toland's birthday?
John Toland was born on November 30, 1670.
When was Gregg Toland born?
Gregg Toland was born on May 29, 1904, in Charleston, Illinois, USA.
When was George Washington - Washington pioneer - born?
George Washington - Washington pioneer - was born in 1817.
Was George Washington born in the state Washington?
No. George Washington was born in Westmoreland, Virginia.
What did the George Washington Carver do for George Washington?
Nothing. George Washington Carver was born after George Washington had died.
When was George Washington Dixon born?
George Washington Dixon was born in 1801.
When was George Washington Triplett born?
George Washington Triplett was born in 1809.
When was George Washington Manypenny born?
George Washington Manypenny was born in 1808.
Trending Questions
What is the difference between a white wizard and a grey wizard?
What is a cantus?
How long should there be light for a fresh water tank?
Who is jimmy studebaker?
On a balance sheet what does members' deficit mean?
What is a fabrica dearmas oviedo 1931 worth?
What does cephalic means in ultrasound?
Words that start with the letter g and end with the letter R?
What is the song from the Glee commercial lyrics are I'm ready now or something like that?
When was greek salad invented?
Why would you expect a dead zone to start near the mouth of a river where the river flows into a body of water?
What are euro notes made of?
What is the definition of the word geo?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
You just burned your finger on a pan that just came out of a 400 degree oven what should you do?
What was the name of Joey's soap opera?
What nationality is the surname Goike?
What is the connotation of the word prim?
Kasukdulan parte ng sa pula sa puti ni francisco rodrigo?
Who wrote the poem street music?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.