answersLogoWhite

0

When was Hamilton Keene born?

User Avatar

Anonymous

∙ 12y ago
Updated: 8/21/2019

Hamilton Keene was born in London, in England, UK.

User Avatar

Wiki User

∙ 12y ago
Copy

What else can I help you with?

Related Questions

When was Barry Keene born?

Barry Keene was born in 1938.


When was Alfred Keene born?

Alfred Keene was born in 1873.


When was Brian Keene born?

Brian Keene was born in 1967.


When was Nelson Keene born?

Nelson Keene was born in 1942.


When was Rick Keene born?

Rick Keene was born in 1957.


When was Henry Keene born?

Henry Keene was born in 1726.


When was Edmund Keene born?

Edmund Keene was born in 1714.


When was Constance Keene born?

Constance Keene was born in 1921.


When was Tommy Keene born?

Tommy Keene was born in 1957.


When was Mattie Keene born?

Mattie Keene was born in c. 1862.


When was Christopher Keene born?

Christopher Keene was born on December 21, 1946.


When was Jasmine Keene born?

Jasmine Keene was born on 1987-01-14.

Trending Questions
When the is mature the sporangium opens? What is the collective noun for ministers? What is top speed of 2005 Chrysler 300C 5.7 liter engine? Was seth Egyptian god seth alive during 3500bc to 3790bc? Will the g52 trans out of 84 Toyota 4wd pickup swap out with w56 trans in 89 Toyota truck 4wd both 4-cylinder? How does fabric affect parachute hangtime? Comparison between general purpose application software and function-specific application function? Why did they cancel Danny Phantom? What size does Ford make wheels in? How do you write 9.21MILLION in number? What is an example of a weak declension? What fraction is divided by 6 to equal 12? What is the relationship between a computer's CPU speed CPU cache and it's main bus speed with regard to the computer's performance? What times what equals -1500 but when added together equals -340? How many promises are in the King James Bible? What is state of being different or unique is? What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT? What does sanding sugar do in sugar cookies? What illness caused perry mason to use a wheel chair? What Middle Eastern country has a sword in its flag?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.