answersLogoWhite

0

When was Heaven's Net is Wide created?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Heaven's Net is Wide was created in 2007.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When was Below the Heavens created?

Below the Heavens was created in 2006.


When was The Mirrored Heavens created?

The Mirrored Heavens was created in 2008.


When was Heavens - band - created?

Heavens - band - was created in 2006.


When was Stream from the Heavens created?

Stream from the Heavens was created in 1994.


When was Beware the Heavens created?

Beware the Heavens was created in 1999.


When was Waiting for the Heavens created?

Waiting for the Heavens was created in 2004-12.


When was Decoding the Heavens created?

Decoding the Heavens was created in 2008-11.


When was Heavens to Betsy created?

Heavens to Betsy was created in 1991.


When was Heavens Fall created?

Heavens Fall was created on 2007-05-16.


When was Good Heavens created?

Good Heavens was created on 1976-02-29.


When was Hang You from the Heavens created?

Hang You from the Heavens was created on 2009-03-11.


When was The Heavens Are Telling created?

The Heavens Are Telling was created on 2003-11-04.

Trending Questions
Is there a recall on 2006 PT cruiser? Where do you go to get a permit to put up a fence in LA? What is the mRNA strand for ggctatatcctgcgctatacgcta? In legend of Zelda spirit tracks I cannot reach the ice temple stamp station my boomerang does not reach the icy fire in that room how do I get the stamp? Which Ohio State Football player is called Animal? Worsted system and woolen system? What is another name for a tire's height? How many days old are you today if you were born March 8 1949? Is ohm's law applicable to ac or dc and why? Son and daughter of Ferdinand Magellan? How big is Selena gomez's mole? What is the value of a 2003 US dollar coin? Animals in trenches? Does Minnesota have tolls on its roads? What is 147 square feet converted to square meters? Is this statement true premiums for term life insurance decrease as people get older? What should I do if my toilet has a weak flush? When was Mann Kee Awaaz Pratigya created? What is the recipricol of 7654321? What is the unit price of a product?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.