0
What else can I help you with?
Related Questions
When did Henry Schwarzschild die?
Henry Schwarzschild died in 1996.
When was Steven Schwarzschild born?
Steven Schwarzschild was born in 1924.
When was Karl Schwarzschild born?
Karl Schwarzschild was born on October 9, 1873.
When was Martin Schwarzschild born?
Martin Schwarzschild was born on 1912-05-31.
What is Karl Schwarzschild's birthday?
Karl Schwarzschild was born on October 9, 1873.
When did Steven Schwarzschild die?
Steven Schwarzschild died in 1989.
When did Martin Schwarzschild die?
Martin Schwarzschild died on 1997-04-10.
How old was Karl Schwarzschild at death?
Karl Schwarzschild died on May 11, 1916 at the age of 42.
How do you say Schwarzschild?
swore-ts-child (i think)
When was Henry born?
Henry Henry was born in 1846.
What is the schwarzschild radius of earth?
The schwarzschild radius of the Earth is about 8.7 x 10 to the negative 3m. The schwarzschild radius is the radis of a sphere that is around a non-rotating blackhole. You find the Rs, or radis, by multiplying the gravitational constant(G), the mass(M), and two. You divide this by the speed of light(c) squared.
How much is the escape speed in the schwarzschild radius?
speed of sound
Trending Questions
How do you tell if a real 1969 dodge coronet super bee?
What was the impact of the changing nature of labor and land ownership in the post civil war era?
The functional definition of religion is an example of what?
What is a combination of different substances?
Find the limit of lim sin 4x sin 6x x 0?
What is hard?
Where is the tire sensor on an 2006 Chrysler town and country?
Did banning slavery improve life for black Americans?
What size replacement bulb goes in stepping Santa 36891?
Is there section 8 open waiting in Wayne County?
Have a shifting problem with your grizzly 660 2003?
What Nat West branch has sort code 60 30 21?
What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT?
How do you adjust the rev limiter software in the ECU in an 2006 cobalt lt?
Could cellular respiration happen without photosynthesis explain your reasoning?
Did the black plague spread east to west?
What is 2 ninths of 180?
Do Wii's have magnets in them?
How do you turn off airbag in vw polo 2000?
What is a chill zone?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.