answersLogoWhite

0

When was Herb Aach born?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Herb Aach was born in 1923.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When did Herb Aach die?

Herb Aach died in 1985.


When was Aalam Lohar born?

Aalam Lohar was born in 1927, in Aach Goach, Punjab, British India.


What has the author Beverly Wade Aach written?

Beverly Wade Aach has written: 'A moment with Bev' -- subject(s): Christian biography 'Call Mom! Easy Cooking Elegant Dining'


When was Herb Roedel born?

Herb Roedel was born in 1939.


When was Herb Pinder born?

Herb Pinder was born in 1923.


When was Herb Grubel born?

Herb Grubel was born in 1934.


When was Herb Conaway born?

Herb Conaway was born in 1963.


When was Herb Grosch born?

Herb Grosch was born in 1918.


When was Herb Scharfman born?

Herb Scharfman was born in 1912.


When was Herb Pfuhl born?

Herb Pfuhl was born in 1928.


When was Herb Pearson born?

Herb Pearson was born in 1910.


When was Herb Peterson born?

Herb Peterson was born in 1919.

Trending Questions
Where should a seven branched menorah be placed? Misprint you have a quarter and on the back it says Northern Mariana islands is that a misprint? Remove the front door speaker landcruiser? How high did sputnik go up? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? Which describes an aspect of total war as it was practiced during the Civil War? What is the Irish Gaelic for 'fire earth metal water and wood'? How can cactus be more useful than a rose? What do governments do to stabilize the economy? What are the harmul affects oxycodeine? What is 10 percent of 650000? Can you use frozen vegetables that have thawed? How do you get a Disney copyright permission? How do you round 735901 to nearest hundred thousand? What is the 2013 murder capital? What maths do you need to know to become an electrician? Calculate heat of fusion? Why some of the word use ed at the end of a word? Can cocci bacteria be found in animals? Timely filing limit for blue cross in Texas?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.