answersLogoWhite

0

When was Hideki Shirakawa born?

User Avatar

APIBirthday ∙

Lvl 1
∙ 15y ago
Updated: 8/18/2019

Hideki Shirakawa was born on August 20, 1936.

User Avatar

Wiki User

∙ 15y ago
Copy

What else can I help you with?

Related Questions

What is Hideki Shirakawa's birthday?

Hideki Shirakawa was born on August 20, 1936.


How old is Hideki Shirakawa?

Hideki Shirakawa is 80 years old (birthdate: August 20, 1936).


What Nobel Prize did Hideki Shirakawa win and when was it awarded?

Hideki Shirakawa won The Nobel Prize in Chemistry in 2000.


What has the author Hideki Shirakawa written?

Hideki Shirakawa has written: 'Kagaku ni miserarete' -- subject(s): Chemists, Macromolecules, Biography


Why did Hideki Shirakawa win The Nobel Prize in Chemistry in 2000?

The Nobel Prize in Chemistry 2000 was awarded jointly to Alan J. Heeger, Alan G. MacDiarmid and Hideki Shirakawa for the discovery and development of conductive polymers.


When was Yoshikazu Shirakawa born?

Yoshikazu Shirakawa was born in 1935.


When was Yukina Shirakawa born?

Yukina Shirakawa was born on June 24, 1985.


When was Emperor Shirakawa born?

Emperor Shirakawa was born on July 7, 1053.


When was Sumiko Shirakawa born?

Sumiko Shirakawa was born on June 26, 1935.


When was Yoshinori Shirakawa born?

Yoshinori Shirakawa was born on 1869-01-24.


When was Daisaku Shirakawa born?

Daisaku Shirakawa was born in 1935, in Kanagawa Prefecture, Japan.


When was Emperor Go-Shirakawa born?

Emperor Go-Shirakawa was born on October 18, 1127.

Trending Questions
What is a Crackin? What is the mean of 2 6 9 7? What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT? What are powers directly stated in the constitution called? What is the cpt code for deviated septum? What are the advantages and disadvantages of modern n traditional tools? Is shelter a problem in Uganda? What is the Hawaiian word for muffin? Was the Mexican War a defensive war or a war of aggression? How do you simplify fractions such as 2 over 6? Where is the pineal body found? What is the medical term for protrusion of the eye? Where can one find HSBC bank branches in the UK? Who are the people in the illiminati? How do you stop ruining the bottom of your shoes? How does the elevation affect the climate in mesoamerica? Where does the African leopard shelter? How long does it take a hyperscan from the us get to Spain? Who is the main star in the Rascal Flatts video? Where can you watch Sugar Sugar Rune episode 36 in English subtitles?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.