0
Incident In San Francisco was created in 1971.
What else can I help you with?
Related Questions
Place where a local school board's attempt to segregate Japanese children created an international incident?
San Francisco, CA
When was San Francisco Independent created?
San Francisco Independent was created in 1987.
When was InterContinental San Francisco created?
InterContinental San Francisco was created in 2008.
When was Theme from San Francisco created?
Theme from San Francisco was created in 1936.
When was San Francisco Opera created?
San Francisco Opera was created in 1923.
When was San Francisco Oracle created?
San Francisco Oracle was created in 1966.
When was San Francisco Solano created?
San Francisco Solano was created in 1949.
When was San Francisco Challenger created?
San Francisco Challenger was created in 1936.
When was San Francisco Chief created?
San Francisco Chief was created in 1954.
When was San Francisco Nighthawks created?
San Francisco Nighthawks was created in 1995.
When was San Francisco Dragons created?
San Francisco Dragons was created in 2006.
When was San Francisco Giants created?
San Francisco Giants was created in 1883.
Trending Questions
What is 15 billion divided by 111 million?
What is the process by which plants and other organisms use sunlight to convert carbon dioxide and water into oxygen and glucose, and what can do photosynthesis?
Should you cut back lantana plants for the winter?
What would cause my 2001 Chrysler town and country's heat-ac blower control to only work on high speed For both the front and rear controls. Could be as simple as a fuse or is it the control panel?
Was Christ born in Ethiopia?
What exercises should I do to improve my overall fitness level?
How can we promote a culture of respect and appreciation for the female body?
What rhymes with Justus?
What effects does hard dry soil have on flooding?
What does a open circle mean of line graph?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
What time is it in Hawaii if it is 8 am in minnesota?
Do you take out the tampon applicator when you use a tampon?
What happens if a person becomes ruffled in a tense situation?
Words ending with the letter g?
What zone does coral live at?
What are the release dates for Silent Angels The Rett Syndrome Story - 2000 TV?
What is ncoridcoiia unscrambled in Spanish?
What is the duration of Pauly Shore Is Dead?
Are there any alternative bands with an electric violinist?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.