answersLogoWhite

0

When was JazzFest Berlin created?

User Avatar

Anonymous

∙ 12y ago
Updated: 8/21/2019

JazzFest Berlin was created in 1964.

User Avatar

Wiki User

∙ 12y ago
Copy

What else can I help you with?

Related Questions

What are the release dates for Jazzfest 2002 The New Orleans Jazz and Heritage Festival - 2002 TV?

Jazzfest 2002 The New Orleans Jazz and Heritage Festival - 2002 TV was released on: USA: 17 August 2002


When was A Berlin Republic created?

A Berlin Republic was created in 1997.


When was Berlin Diary created?

Berlin Diary was created in 1941.


When was Hakoah Berlin created?

Hakoah Berlin was created in 1905.


When was Destination Berlin created?

Destination Berlin was created in 1989.


When was Fernmeldeturm Berlin created?

Fernmeldeturm Berlin was created in 1964.


When was Berlin Marathon created?

Berlin Marathon was created in 1974.


When was Staatskapelle Berlin created?

Staatskapelle Berlin was created in 1570.


When was Berlin Journal created?

Berlin Journal was created in 1881.


When was Olymp Berlin created?

Olymp Berlin was created in 1900.


When was Judgment in Berlin created?

Judgment in Berlin was created in 1984.


When was Berlin Rebels created?

Berlin Rebels was created in 1987.

Trending Questions
When the is mature the sporangium opens? What is the collective noun for ministers? What is top speed of 2005 Chrysler 300C 5.7 liter engine? Was seth Egyptian god seth alive during 3500bc to 3790bc? Will the g52 trans out of 84 Toyota 4wd pickup swap out with w56 trans in 89 Toyota truck 4wd both 4-cylinder? How does fabric affect parachute hangtime? Comparison between general purpose application software and function-specific application function? Why did they cancel Danny Phantom? What size does Ford make wheels in? How do you write 9.21MILLION in number? What is an example of a weak declension? What fraction is divided by 6 to equal 12? What is the relationship between a computer's CPU speed CPU cache and it's main bus speed with regard to the computer's performance? What times what equals -1500 but when added together equals -340? How many promises are in the King James Bible? What is state of being different or unique is? What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT? What does sanding sugar do in sugar cookies? What illness caused perry mason to use a wheel chair? What Middle Eastern country has a sword in its flag?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.