0
What else can I help you with?
Related Questions
When was John Jeremie born?
John Jeremie was born in 1795.
When was James Jeremie born?
James Jeremie was born in 1802.
Who won the gold medal in men's lightweight double sculls at the Rio 2016 Olympics?
The gold medal in the Men's Lightweight Double Sculls at the Rio 2016 Olympics went to Pierre Houin and Jeremie Azou.
When was Rabaki Jeremie Ouedraogo born?
Rabaki Jeremie Ouedraogo was born in 1973.
When was Jeremie Miller born?
Jeremy Miller was born on October 21, 1976.
Where was Jeremie Blain born?
Jeremie Blain was born in Le Moyne, Quebec on 03-19-92.
When was Jeremie Bowles born?
Jeremie Bowles was born on July 31, 1985, in Cardiff, Wales, UK.
When was Jeremie Blanc Shapira born?
Jeremie Blanc Shapira was born on October 15, 1960, in Middletown, Connecticut, USA.
How old is Jeremie Blain?
NHL player Jeremie Blain was born on 03-19-92 and as of the end of the 2013-2014 season is 22 years old.
When did James Jeremie die?
James Jeremie died in 1872.
How tall is Jeremie Saunders?
Jeremie Saunders is 5' 9".
How tall is Joelle Jeremie?
Joelle Jeremie is 5' 2".
Trending Questions
Can a parent kick you out if you are over the age of 18?
What is the Gosselin family's political affiliation?
How tall is Radhaa Nilia?
What level does lombre learn fake out?
Which of the following is NOT one of the so-called pillars of primary health care as outlined by the Declaration of Alma Ata?
What are animal claws used for?
What is the distance between two longitudes at the equator?
Does ingrown toenail surgery hurt?
When was Black dress of Rita Hayworth created?
Who does Mr Pilkington represent in Animal Farm?
Is the moon made out of sand?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What if caffeine does not have an effect on you?
What is the definition of futile?
Why is there an Australian midget pooping in your attic?
How much does a cintas ssr make?
Michael's Coupons?
What does miogynistic mean?
What are three examples of governmental actions that might interfere with free market?
What are the 4 major civic duties?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.