0
What else can I help you with?
Related Questions
How old is Jim E. Marshall?
Jim E. Marshall is 50 years old. He was born on April 2, 1960.
When was Jim Marshall born?
Jim Marshall was born on February 3, 1936.
When was Jim Marshall - businessman - born?
Jim Marshall - businessman - was born on 1923-07-29.
When was Jim Marshall - broadcasting executive - born?
Jim Marshall - broadcasting executive - was born in 1962.
What is Jim Marshall's birthday?
Jim Marshall was born on February 3, 1936.
When and where was baseball player Jim Marshall born?
Jim Marshall was born May 25, 1931, in Danville, IL, USA.
When was E. Pierce Marshall born?
E. Pierce Marshall was born in 1939.
When was E. G. Marshall born?
E. G. Marshall was born on June 18, 1914.
When was Marshall E. Cornett born?
Marshall E. Cornett was born on 1898-11-22.
What is E. G. Marshall's birthday?
E. G. Marshall was born on June 18, 1914.
Is Jim Marshall still alive?
Jim Marshall is not alive anymore.
How old is Jim Marshall?
Ex-NFL lineman Jim Marshall is 80 years old (birthdate: December 30, 1937). UK businessman James C. "Jim" Marshall was 88 years old when he died on April 5, 2012 (born July 29, 1923)
Trending Questions
Roosevelts New Nationalism program primarily hoped to?
Two numbers have a sum of 31 and a product of 228 What are the numbers?
What Native American group that lived in the American southwest also known for cliff dwellings?
Who were the green police of Holocaust?
What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT?
What does it means when a boy says there were taking a cold shower?
How do you get the clear bell in Pokemon liquid crystal?
Who got ball first in the Super Bowl this year?
What is the trigonometric values 82 degrees and 12 minutes using 3 major functions?
What should one do during a lion attack?
What is 42 over 441 in simplest form?
What percent of people in their late teens and early twenties have credit cards?
What does an egg represent when given as a gift?
What is a plutino?
When was Dónal Clifford born?
How did the northerners and Southerns view the secession of the south States?
What is Freeze Screen Saver exe Is it good or bad. Should I remove it from PC?
What happens when a relay is operated beyond its rated voltage or current?
What does tu es amusant mean?
What is the motto of Tintern Schools?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.