0
What else can I help you with?
Related Questions
When and where was baseball player Jimmy Say born?
Jimmy Say was born ? , 1862, in Baltimore, MD, USA.
When did Jimmy Say die?
Jimmy Say died on 1894-06-23.
When was Jimmy Woode born?
Jimmy Woode was born on October 24, 1912.
When was Jimmy Fullam born?
Jimmy Fallon was born on September 19, 1974.
When was Jimmy Harte born?
Jimmy Hart was born on January 1, 1944.
When was Jimmy Cochrane born?
Jimmy Cochrane was born on 1935-10-26.
When was Jimmy Deane born?
Jimmy Dean was born on August 10, 1928.
When was Jimmy Nichol born?
Jimmy Nicholl was born on February 28, 1956.
When was Jimmy Sharp born?
Jimmy Sharpe was born in 1940.
When was Jimmy Carruth born?
Jimmy Carruth was born in 1969.
When was Jimmy McLarnin born?
Jimmy McLarnin was born on December 19, 1907.
When was Jimmy Wagner born?
Jimmy Wagner was born in 1952.
Trending Questions
What is the volume of a rectangular prism with a lenght of 10cm a width of 7cm and a height of 5cm?
Who played Seth Bullock on Deadwood?
What is Jenny Craig's phone number?
What do you think the reason is?
What is the percentage of freshwater is groundwater?
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
How does the order of characteristics on a branching tree diagram help demonstrate evolutionary history?
What were the Banana Wars?
If a person files for divorce in North Carolina and cannot serve the other spouse with the divorce papers what would be the status of the divorce?
What is 6 over 39?
Can your boyfriend get in love about licking him?
Who appointed Gerald ford as vice president?
Where do they sell cachetadas candy in Houston?
What are the features and benefits of the keychain viewfinder?
Are you a child of a god or goddess?
Are there any male singers whose musical type is Like Amy winehouse or duffy or joss stone?
What is size of Alberta Canada?
Why were conspirators against Caesar?
Change a starter on 99 Acura TL?
Bakit sinasabing nag-simula ang pabula kay Aesop?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.