0
What else can I help you with?
Related Questions
When did John Lager die?
John Lager died in 1961.
When was Mildred Lager born?
Mildred Lager was born in 1900.
When was Gunnar Lager born?
Gunnar Lager was born in 1888.
When was Eric Lager born?
Eric Lager was born on March 16, 1992.
When was Jesper Lager born?
Jesper Lager was born on May 15, 1972.
When was Nina Lager born?
Nina Lager was born on November 23, 1974.
When was Brad Lager born?
Brad Lager was born on 1975-06-20.
When was Hélène de Saint Lager born?
Hélène de Saint Lager was born in 1957.
When was Hampus Lager born?
Hampus Lager was born on February 22, 1988, in Karlskrona, Blekinge ln, Sweden.
When was Nils Lager born?
Nils Lager was born on April 18, 1980, in Lidkping, Vstra Gtalands ln, Sweden.
What is an Irish lager?
An Irish lager is a beer
What has more acid Guinness or lager?
Lager
Trending Questions
How can I spend more time with horses if I dont have my own?
What is b squared to 100?
Who settled the colony of caralina?
What answer did shadrack make to the unasked question?
What is the names of all jls members?
Sharp atomic clock SPC373 can not get your outside temp to set?
What is the origin of wig?
What steps did Lincoln take to preserve the union before and after the fighting at fort Sumter?
What are the best techniques for applying whitewash paint to brick surfaces?
96 mercury mystique fuse configuration?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
How do crafts help in school?
What do the bells do in the plaza in Kirby's epic yarn?
What did the Byzantine empire do to control the Roman Empire?
Can a pastor have someone committed?
What are some famous people that begin with the letter z?
What is controllable and uncontrollable cost?
Where can you have an outdoor outing in Rhode Island?
Where is the Oxygen sensor on a 1997 4runner?
What movies has Anna popplewell starred in?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.