0
What else can I help you with?
Related Questions
When was Elías Sapag born?
Elías Sapag was born in 1911.
When was Luz Sapag born?
Luz Sapag was born in 1944.
When was Felipe Sapag born?
Felipe Sapag was born on 1917-02-14.
When was Mario Sapag born?
Mario Sapag was born on May 25, 1935, in Buenos Aires, Argentina.
When did Elías Sapag die?
Elías Sapag died in 1993.
When did Luz Sapag die?
Luz Sapag died in 2010.
When did Felipe Sapag die?
Felipe Sapag died on 2010-03-14.
When did Mario Sapag die?
Mario Sapag died on April 14, 2012, in Buenos Aires, Argentina.
What has the author Nassir Sapag Chain written?
Nassir Sapag Chain has written: 'Criterios de Evaluacion de Proyectos'
When was Jorge Hernandez Aldana born?
Jorge Hernandez Aldana was born in 1969, in Caracas, Venezuela.
When was Jorge Cottini born?
Jorge Cottini was born in 1962.
When was Jorge Timossi born?
Jorge Timossi was born in 1936.
Trending Questions
What is Harry Styles from one direction favorite football team?
Is Utah Nevada Idaho and Western Colorado are all part of the Western Frontier?
What is the ratio for a visage from King Black Dragon?
How old where people when they joined world war 2?
How much should a 4'6 8 year old boy weigh?
What does the word mean having to do with community worship?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
What are codes called when procedures are grouped together?
When was Charles S. Kaelin born?
What is the law in Texas about children riding in the front seat of a vehicle?
What happened to miners and towns when the gold ran out?
Do organelles use energy from sunlight to produce food are called mitochondria?
What are five methods of nomination used today include?
How much work will be needed to lift a block weighin 4 newtons and a distance of 10 meters?
How old do you have to be to get a tattoo in Missouri if you already have one?
Have Holly Willoughby and Stephen Mulhern ever dated?
What tectonic plates does the eyjafjallajokull sit on?
How much transmission fluid do you need to change in a 1991 Toyota Land Cruiser?
What historical events happened in 1933?
What are the 5 odd numbers whose sum is 50 from 1 to 49?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.