answersLogoWhite

0

When was Katelyn Epperly born?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Katelyn Epperly was born on March 21, 1990, in Des Moines, Iowa, USA.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

Who is Katelyn Epperly?

Katelyn Epperly is a US actress, born March 21, 1990. She was one of 8 semi-finalist female singers on the 9th season of American Idol (early 2010).


When was Al Epperly born?

Al Epperly was born on 1918-05-07.


When was Bruce G. Epperly born?

Bruce G. Epperly was born in 1952.


When was Rachel Epperly born?

Rachel Epperly was born on April 14, 1989, in Gahanna, Ohio, USA.


When and where was baseball player Al Epperly born?

Al Epperly was born May 7, 1918, in Glidden, IA, USA.


When was Katelyn Tarver born?

Katelyn Tarver was born on November 2, 1989.


When was Katelyn Good born?

Katelyn Good was born on 1990-11-08.


When was Katelyn Ohashi born?

Katelyn Ohashi was born on 1997-04-12.


When was Katelyn Cahill born?

Katelyn Cahill was born on August 19, 1989, in Canton, Massachusetts, USA.


What is Katelyn Tarver's birthday?

Katelyn Tarver was born on November 2, 1989.


When was Katelyn Salmont born?

Katelyn Salmont was born on September 7, 1986, in Santa Clarita, California, USA.


When was Katelyn Pigoni born?

Katelyn Pigoni was born on September 25, 1989, in Santa Rosa, California, USA.

Trending Questions
Should I have my car wrapped? Why does light have a dual wave particle model? What does the carrying of seeds to a new place? What was F. Scott Fitzgerald's daughter's name? What is the lecithin daily intake? What did suyuan woo tell an-mei when an-mei prepared for her trip to china? What cranial nerve is used for pupillary constriction? Can you use August in a sentence please? How many electrons in one columb? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? What is the significance of the spiritual rosary in the practice of prayer and meditation? How many votes does each state have in the electorial college? What is the closest airport to Osage Beach MO? How do you remove center console from 2004 Hyundai xg350? Is the Grand National cruel? What are symptoms of chiari malformation? What is the most poinsonous land snake? How do you integrate e powerintegral2x-1? Deciduous trees are those that? What is the US Mining Law of 1812?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.