answersLogoWhite

0

When was Kohei Yoshiyuki born?

User Avatar

Anonymous

∙ 12y ago
Updated: 8/21/2019

Kohei Yoshiyuki was born in 1946.

User Avatar

Wiki User

∙ 12y ago
Copy

What else can I help you with?

Related Questions

When was Kohei Ezaki born?

Kohei Ezaki was born in 1904.


When was Kohei Nishiyama born?

Kohei Nishiyama was born in 1970.


When was Kohei Nasu born?

Kohei Nasu was born in 1942.


When was Kohei Murakami born?

Kohei Murakami was born in 1976.


When was Kohei Suwama born?

Kohei Suwama was born on November 23, 1976.


When was Kohei Hiramatsu born?

Kohei Hiramatsu was born on 1980-04-19.


When was Kohei Yamada born?

Kohei Yamada was born on 1989-01-08.


When was Kohei Shimizu - skier - born?

Kohei Shimizu - skier - was born in 1989.


When was Kohei Kuroki born?

Kohei Kuroki was born on 1989-07-31.


When was Kohei Mishima born?

Kohei Mishima was born on 1987-04-15.


When was Kohei Hirate born?

Kohei Hirate was born on March 24, 1986.


When was Kohei Kiyama born?

Kohei Kiyama was born on 1988-02-22.

Trending Questions
How many championships does Liverpool fc have? How can I create precise and clean rabbet cuts in my woodworking project? What kind of dog is Asta in The Thin Man? What did the people in the Middle Colonies wear? Where is the heated front seat module in 1999 jag xj8? What is the name of Iran's and Pakistan's border? Where can you download tera kya hoga johnny movie songs? What is 15 out of 40 as a fraction in its lowest terms? Very few cells are replaced in this organ system? How much does 275 milliliters equal in liters? Will a 60000 volt coil work with a stock 302? How do you write a sentence with the word privacy? What is the visitation in Catholicism? Why do diatoms have oil filled vaculoes? What's an easy way to get mushrooms on Pokemon Dark Rising? Why will a guy whistle when he sees a girl? What song does Lil Wayne diss Eminem in? How do you replace the front turn signal bulb located on a 1998 Mercury Grand Marquis? What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa? The general mood that prevailed in the 1920s was?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.