answersLogoWhite

0

When was Leeds New railway station created?

User Avatar

Anonymous

∙ 12y ago
Updated: 8/21/2019

Leeds New railway station was created in 1869.

User Avatar

Wiki User

∙ 12y ago
Copy

What else can I help you with?

Related Questions

When did Leeds New railway station end?

Leeds New railway station ended in 1938.


When was New Beckenham railway station created?

New Beckenham railway station was created in 1866.


When was Kilsyth New railway station created?

Kilsyth New railway station was created in 1888.


When was New Romney railway station created?

New Romney railway station was created in 1927.


When was New Malden railway station created?

New Malden railway station was created in 1846.


When was New Cumnock railway station created?

New Cumnock railway station was created in 1850.


When was New Hythe railway station created?

New Hythe railway station was created in 1929.


When was New Cross railway station created?

New Cross railway station was created in 1850.


When was New Galloway railway station created?

New Galloway railway station was created in 1861.


When was New Eltham railway station created?

New Eltham railway station was created in 1878.


When was New Bolingbroke railway station created?

New Bolingbroke railway station was created in 1913.


When was New Brighton railway station created?

New Brighton railway station was created in 1888.

Trending Questions
Is jade dynasty better than RuneScape? What does ursinologist use? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? How are the grade equivalent score interpreted? What is the need to dispose of waste materials and consumables? How tall is Greg Camilleri? What is the weight of A5 paper? What are advantages and disadvantages of a proscenium stage? What type of credit check, hard or soft, will be conducted during the application process? What is tattooed on Popeye's bulging forearms? Did Andrew Carnige use horizontal or vertical consolidation to gain control of the steel industry? How has tried The Idiot Proof Diet generator diet? Is smelly fish bad? What type of polygon carries a total angle of 1800 degrees? How many 5ps go into 3 ponds? What animals live in lake okeechobee? What is the area of Tronzano Lago Maggiore? When did the Spamalot musical comedy first perform? Where could one get free advice from a debt consolidation company? What is the reasons for global spatial distribution of deserts?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.