answersLogoWhite

0

When was Loongkoonan born?

User Avatar

Anonymous

∙ 12y ago
Updated: 8/21/2019

Loongkoonan was born in 1910.

User Avatar

Wiki User

∙ 12y ago
Copy

What else can I help you with?

Related Questions

When was Ann Hutchins born?

she was born when she was born she was born when she was born


What is the definition for the word lair?

Boyence was born at? Where was yuyi born? When elisabeta born? When was palto born? When was yhgjh born? When was shera born? When was myunwa born? When was fuzuli born? When was sullar born? When was mjfast born? Were was she born at? Where was sonai born? Where wasstluke born?


What is the present tense of born?

To become born: He is being born. He was born. He will be born.


What is the difference between you were born on and you were born in?

you were born on means the date. you were born in means where you were born.


When was Iris Born born?

Iris Born was born in 1954.


When was Ivan Born born?

Ivan Born was born in 1778.


When was Gary Born born?

Gary Born was born in 1955.


When was Wina Born born?

Wina Born was born in 1920.


When was Anne Born born?

Anne Born was born in 1924.


When was Stephen Born born?

Stephen Born was born in 1824.


When was Friedrich Born born?

Friedrich Born was born in 1903.


When was Ernest Born born?

Ernest Born was born in 1898.

Trending Questions
What is the difference between a white wizard and a grey wizard? What is a cantus? How long should there be light for a fresh water tank? Who is jimmy studebaker? On a balance sheet what does members' deficit mean? What is a fabrica dearmas oviedo 1931 worth? What does cephalic means in ultrasound? Words that start with the letter g and end with the letter R? What is the song from the Glee commercial lyrics are I'm ready now or something like that? When was greek salad invented? Why would you expect a dead zone to start near the mouth of a river where the river flows into a body of water? What are euro notes made of? What is the definition of the word geo? What is the correct complementary DNA starnd for gacatcgttgactacggctgatc? You just burned your finger on a pan that just came out of a 400 degree oven what should you do? What was the name of Joey's soap opera? What nationality is the surname Goike? What is the connotation of the word prim? Kasukdulan parte ng sa pula sa puti ni francisco rodrigo? Who wrote the poem street music?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.