0
What else can I help you with?
Related Questions
What movie and television projects has Manon Gaurin been in?
Manon Gaurin has: Played Nina Lavida in "Le juge est une femme" in 1993. Played Lucie in "Le dirlo: Lucie" in 2003. Performed in "Capitaine Lawrence" in 2003. Played Caroline Manesco in "Section de recherches" in 2006. Played Lola in "Duval et Moretti" in 2008. Played Lucie Aubras in "Dangereuses retrouvailles" in 2013.
When was Manon Spierenburg born?
Manon Spierenburg was born in 1969.
When was Manon Ossevoort born?
Manon Ossevoort was born in 1976.
When was Manon Charette born?
Manon Charette was born in 1955.
When was Manon Kahle born?
Manon Kahle was born in 1980.
When was Manon Balletti born?
Manon Balletti was born in 1740.
When was Manon Rhéaume born?
Manon Rhéaume was born on February 24, 1972.
When was Manon Chevallier born?
Manon Chevallier was born on January 16, 1998.
When was Manon Jomain born?
Manon Jomain was born on August 26, 1979.
When was Lydia Manon born?
Lydia Manon was born on 1982-09-16.
When was Manon Melis born?
Manon Melis was born on 1986-08-31.
When was Manon Perreault born?
Manon Perreault was born on 1965-12-29.
Trending Questions
Where should a seven branched menorah be placed?
Misprint you have a quarter and on the back it says Northern Mariana islands is that a misprint?
Remove the front door speaker landcruiser?
How high did sputnik go up?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
Which describes an aspect of total war as it was practiced during the Civil War?
What is the Irish Gaelic for 'fire earth metal water and wood'?
How can cactus be more useful than a rose?
What do governments do to stabilize the economy?
What are the harmul affects oxycodeine?
What is 10 percent of 650000?
Can you use frozen vegetables that have thawed?
How do you get a Disney copyright permission?
How do you round 735901 to nearest hundred thousand?
What is the 2013 murder capital?
What maths do you need to know to become an electrician?
Calculate heat of fusion?
Why some of the word use ed at the end of a word?
Can cocci bacteria be found in animals?
Timely filing limit for blue cross in Texas?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.