answersLogoWhite

0

When was Mariela Castro born?

User Avatar

Anonymous

∙ 12y ago
Updated: 8/21/2019

Mariela Castro was born on 1961-07-27.

User Avatar

Wiki User

∙ 12y ago
Copy

What else can I help you with?

Related Questions

Who is the leading advocate of gay rights in Cuba?

Mariela Castro, daughter of Cuban President Raul Castro and niece of former President Fidel Castro.


When was Mariela Griffor born?

Mariela Griffor was born in 1961.


When was Mariela Antoniska born?

Mariela Antoniska was born in 1975.


When was Mariela González born?

Mariela González was born in 1974.


When was Mariela Ortiz born?

Mariela Ortiz was born on August 5, 1976.


When was Mariela Pérez born?

Mariela Pérez was born on 1946-02-14.


When was Mariela Coronel born?

Mariela Coronel was born on 1981-06-20.


When was Mariela Comitini born?

Mariela Comitini was born on August 8, 1977, in Buenos Aires, Argentina.


When was Mariela Morales born?

Mariela Morales was born on March 17, 1981, in Buenos Aires, Argentina.


When was Mariela Vitale born?

Mariela Vitale was born on December 20, 1982, in Buenos Aires City, Distrito Federal, Argentina.


When was Mariela Mastrangelo born?

Mariela Mastrangelo was born on May 24, 1974, in New York City, New York, USA.


When was Jaime Castro Castro born?

Jaime Castro Castro was born in 1939.

Trending Questions
What is the difference between a white wizard and a grey wizard? What is a cantus? How long should there be light for a fresh water tank? Who is jimmy studebaker? On a balance sheet what does members' deficit mean? What is a fabrica dearmas oviedo 1931 worth? What does cephalic means in ultrasound? Words that start with the letter g and end with the letter R? What is the song from the Glee commercial lyrics are I'm ready now or something like that? When was greek salad invented? Why would you expect a dead zone to start near the mouth of a river where the river flows into a body of water? What are euro notes made of? What is the definition of the word geo? What is the correct complementary DNA starnd for gacatcgttgactacggctgatc? You just burned your finger on a pan that just came out of a 400 degree oven what should you do? What was the name of Joey's soap opera? What nationality is the surname Goike? What is the connotation of the word prim? Kasukdulan parte ng sa pula sa puti ni francisco rodrigo? Who wrote the poem street music?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.