0
What else can I help you with?
Related Questions
When was stomp created?
Zombie Stomp was created in 1991.
When was Zombie Stomp created?
Zombie Stomp was created in 1991.
When was Sanity Stomp created?
Sanity Stomp was created in 1980.
When was Stomp Out Loud created?
Stomp Out Loud was created in 1997.
When was Stomp on Tripwires created?
Stomp on Tripwires was created in 2003-11.
When was Stomp the Yard created?
Stomp the Yard was created on 2007-01-12.
When was Pin Heel Stomp created?
Pin Heel Stomp was created on 1997-11-30.
When was Honky Tonk Stomp created?
Honky Tonk Stomp was created on 2009-08-10.
When was Stomp - Steps song - created?
Stomp - Steps song - was created on 2000-10-16.
When was Bron-Y-Aur Stomp created?
Bron-Y-Aur Stomp was created on -19-08-05.
When was STOMP founded?
stomp dance was created because African people ,when they were working mines they wore gum boot's so they'd stomp to communicate.
Who created stomp?
Steve McNicholas and Luke Cresswell
Trending Questions
When was Northern Nevada Correctional Center created?
Is wood laminate flooring cheap?
What are the names of the main characters in the thief?
Where might one look to find a United Airlines flight status?
What is Bruno Mars favorite season?
How do you clean pet urine from suede sofa?
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
What does RAFT stand for in language arts?
What is Heller's test?
What are the list of Aerial Animals?
What are the gifts for run santa run in doodle god?
Where does a ship park?
Which system has parties that are made of coalitions?
What is the meaning of intermediate?
What does non recyclable mean?
Why the Framers did not anticipate the feature of the electoral college system?
Why did Hollis run away from the regans family in pictures of hollis woods?
What innate behavior does a white tiger have?
Which clan did the Yamato clan originate?
What to do to a chicken when it has been attacked by a dog and still alive?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.