0
Michael Townsend Wright was born on February 28, 1956, in Red Bank, New Jersey, USA.
What else can I help you with?
Related Questions
How tall is Michael Townsend Wright?
Michael Townsend Wright is 5' 8".
When was Michael Townsend born?
Michael Townsend was born on 1986-05-17.
When was Michael Townsend Smith born?
Michael Townsend Smith was born in 1935.
When was John Michael Wright born?
John Michael Wright was born in 1617.
When was Michael Wright - actor - born?
Michael Wright - actor - was born on 1956-04-30.
When was Michael Wright - basketball - born?
Michael Wright - basketball - was born on 1980-01-07.
When was Michael Wright - Australian footballer - born?
Michael Wright - Australian footballer - was born on 1959-10-06.
What nicknames does John Michael Townsend go by?
John Michael Townsend goes by JT.
What actors and actresses appeared in Blood Bank - 2012?
The cast of Blood Bank - 2012 includes: Leatha Sturges as Old Woman Michael Townsend Wright as Dr. Vengel
When was Ralph Townsend born?
Ralph Townsend was born in 1951.
When was Norman Townsend born?
Norman Townsend was born in 1924.
When was Les Townsend born?
Les Townsend was born in 1914.
Trending Questions
What should you do to leave merry-go-round in order not to fall down?
What is the meaning of the laundry pin on a bikers jacket?
What is the chemical that blocks most of the ultraviolet light from reaching earth?
How many ATM of pnb in kolkata?
Im almost 15 and im 5'2 most of my friends are taller than me am i under the average do you think?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
What is the last sense to leave the body when you die?
How did Girl Guides begin?
What was one of the archangels named in the Hebrew tradition?
Why is RNA needed in a cell?
Where did endless shoes come from?
Why did the US intervene in the Mexican Revolution?
How much did Turtle win in the Westing Game?
Why did New Zealand john walker become a athlete?
How willu obtain butan-2-ol from propanal?
How do you get on top of Hideki tower on Skate 2 for Xbox 360?
When did Samuel Tertius Galton die?
Where can you buy vernors in Michigan?
What is the largest nuclear charge of group 2?
Does Connecticut have a football team?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.