0
What else can I help you with?
Related Questions
When was Houlihan Lokey created?
Houlihan Lokey was created in 1972.
What is the birth name of Ian Lokey?
Ian Lokey's birth name is Ian Spencer Lokey.
What is the population of Houlihan Lokey?
Houlihan Lokey's population is 800.
When was Lorry I. Lokey born?
Lorry I. Lokey was born on 1927-03-27.
When was Derek Lokey born?
Derek Lokey was born on 1985-11-25.
How tall is William Grant Lokey?
William Grant Lokey is 5' 9".
When was Hicks Lokey born?
Hicks Lokey was born on April 5, 1904, in Alabama, USA.
What is Houlihan Lokey's motto?
Houlihan Lokey's motto is 'Delivering insight and expertise to help advance your vision'.
When was Ian Lokey born?
Ian Lokey was born on October 11, 1985, in Plano, Texas, USA.
When did Hicks Lokey die?
Hicks Lokey died on November 4, 1990, in Los Angeles County, California, USA.
In which countries is a Houlihan Lokey located?
"Houlihan Lokey has offices in 6 Countries around the world. They are the US, France, Germany, United Kingdom, China, and Japan."
What rhymes with Lokey?
Hokey, Pokey, Smoky, croaky, troche.
Trending Questions
Calculate the molarity of a H3PO4 solution of 6.66 in 555mL of solution?
What are treatments for splenic trauma?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
Does logh mean forgive in Gaelic?
What is the collect noun for tools?
Are phoenix university credits transferable?
Where is the Unitarian Universalist Church located?
How much solar energy reaches Earth?
What is a female monk called in the Chinese language?
Which theme can be found in both If and The Jungle Book by Rudyard Kipling?
Where is the habitat of Rhizomes?
How much are ballet point shoes at a dance school?
Is 0.323232 rational?
What did George Washington say?
What steps can use to protect yourself from cybercrime?
The three states of matter are?
Is the setting in England for James and the Giant Peach?
Was Australia called Australia in 1901?
Sleepover games for 18 year olds?
What is the denominator of fraction?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.