0
What else can I help you with?
Related Questions
How tall is Ole Tillmann?
Ole Tillmann is 178 cm.
When was Tillmann Uhrmacher born?
Tillmann Uhrmacher was born on 1967-05-14.
When was Tillmann Grove born?
Tillmann Grove was born on 1988-03-09.
When was Ulrike Tillmann born?
Ulrike Tillmann was born on 1962-12-12.
When was Fritz Tillmann born?
Fritz Tillmann was born on December 13, 1910, in Frankfurt am Main, Germany.
When was Patrick Tillmann born?
Patrick Tillmann was born on December 11, 1972, in Marshall, Minnesota, USA.
What is the birth name of Patrick Tillmann?
Patrick Tillmann's birth name is Patrick Michael Tillmann.
How tall is Patrick Tillmann?
Patrick Tillmann is 5' 9".
When was Ole Bendtzen born?
Ole Bendtzen was born in 1976.
When was Ole Brandmeyer born?
Ole Brandmeyer was born in 1986.
When was Ole Pfennig born?
Ole Pfennig was born in 1964.
When was Ole Eisfeld born?
Ole Eisfeld was born in 1973.
Trending Questions
What is the difference between a white wizard and a grey wizard?
What is a cantus?
How long should there be light for a fresh water tank?
Who is jimmy studebaker?
On a balance sheet what does members' deficit mean?
What is a fabrica dearmas oviedo 1931 worth?
What does cephalic means in ultrasound?
Words that start with the letter g and end with the letter R?
What is the song from the Glee commercial lyrics are I'm ready now or something like that?
When was greek salad invented?
Why would you expect a dead zone to start near the mouth of a river where the river flows into a body of water?
What are euro notes made of?
What is the definition of the word geo?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
You just burned your finger on a pan that just came out of a 400 degree oven what should you do?
What was the name of Joey's soap opera?
What nationality is the surname Goike?
What is the connotation of the word prim?
Kasukdulan parte ng sa pula sa puti ni francisco rodrigo?
Who wrote the poem street music?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.