answersLogoWhite

0

When was Payaso created?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Payaso was created in 1952.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When was Parnaso ng Payaso created?

Parnaso ng Payaso was created in 2003.


What is the Spanish name for clown?

The Spanish name for clown is "payaso".


What are the ratings and certificates for Payaso - 1952?

Payaso - 1952 is rated/received certificates of: Argentina:Atp


How old is ese payaso?

ese payaso is 15 look him up on youtube, facebook, and/or myspace


What actors and actresses appeared in Payaso resfriado - 2004?

The cast of Payaso resfriado - 2004 includes: Leonel Henry


What actors and actresses appeared in Payaso Triste - 2007?

The cast of Payaso Triste - 2007 includes: Nate Weisband as Clown


What are the release dates for Payaso - 2011?

Payaso - 2011 was released on: USA: 3 June 2011 (Pittsburgh Film Festival)


What does payaso mean?

Bad clown


What actors and actresses appeared in El payaso se pinta solo - 1995?

The cast of El payaso se pinta solo - 1995 includes: Rodrigo Alonso Mariana Barbera as Payaso Olga Duron Ernesto Medina


What does Mala payaso mean?

Bad clown


What actors and actresses appeared in Payaso - 1952?

The cast of Payaso - 1952 includes: Carlos Castro Lea Conti Francisco Pablo Donadio Malvina Pastorino Luis Sandrini


What are the release dates for Maten al Payaso - 2006?

Maten al Payaso - 2006 was released on: USA: 6 January 2006 (Miami 48 Hour Film Project)

Trending Questions
How do you test 4 wire PT100 temperature sensor RDT? How many amendments in South Carolina's constitution? What are the three most important gods in Hinduism? How long is the flight from Melbourne Australia to the Caribbean? What is 4.28 to the nearest tenths? Can you drink energy drinks with lisinopril? How much should i charge to paint a mailbox? How are hydrographs useful to hydrologists? Once a sedative and cure for nervous tension the ion of this element is now a trite or commonplace expression? how can i make 10 using nine 9s? What is Honduras coin? What is the difference between Romanticism and Naturalism? What time of year did the thylacine breed? What is the balanced chemical equation of HCl and C6H8O7 Citric Acid? Where is the heater control valve located on your 1994 e 150 van? What is the meaning of 'virsa' in Punjabi language? What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT? Where does Ariana Grande get her purple giraffe? What is the classification of a triangle with sides of length 5 inches 12 inches and 13 inches? What is the subscript of sodium chloride?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.