0
What else can I help you with?
Related Questions
When was Pee Wee Lambert born?
Pee Wee Lambert was born in 1924.
When was Pee Wee Reese born?
Pee Wee Reese was born on July 23, 1918.
When was Pee Wee King born?
Pee Wee King was born on February 18, 1914.
When was Pee Wee Wentz born?
Pee Wee Wentz was born on 1941-05-26.
When was Pee Wee Crayton born?
Pee Wee Crayton was born on 1914-12-18.
When was Leon 'Pee Wee' Whittaker born?
Leon 'Pee Wee' Whittaker was born in 1906.
When was Pee-Wee Wanninger born?
Pee-Wee Wanninger was born on 1902-12-12.
When was Pee Wee Vignold born?
Pee Wee Vignold was born on July 3, 1971, in Essen, Germany.
When was Alfred 'Pee Wee' Ellis born?
Alfred 'Pee Wee' Ellis was born on 1941-04-21.
What is Pee Wee King's birthday?
Pee Wee King was born on February 18, 1914.
What is Pee Wee Russell's birthday?
Pee Wee Russell was born on March 27, 1906.
What is Pee Wee Reese's birthday?
Pee Wee Reese was born on July 23, 1918.
Trending Questions
What is the difference between a white wizard and a grey wizard?
What is a cantus?
How long should there be light for a fresh water tank?
Who is jimmy studebaker?
On a balance sheet what does members' deficit mean?
What is a fabrica dearmas oviedo 1931 worth?
What does cephalic means in ultrasound?
Words that start with the letter g and end with the letter R?
What is the song from the Glee commercial lyrics are I'm ready now or something like that?
When was greek salad invented?
Why would you expect a dead zone to start near the mouth of a river where the river flows into a body of water?
What are euro notes made of?
What is the definition of the word geo?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
You just burned your finger on a pan that just came out of a 400 degree oven what should you do?
What was the name of Joey's soap opera?
What nationality is the surname Goike?
What is the connotation of the word prim?
Kasukdulan parte ng sa pula sa puti ni francisco rodrigo?
Who wrote the poem street music?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.