0
What else can I help you with?
Related Questions
When did Pierre Colliander die?
Pierre Colliander died in 1956.
When was Sven Colliander born?
Sven Colliander was born in 1890.
When was James Colliander born?
James Colliander was born on 1967-06-22.
When was Aldo Colliander born?
Aldo Colliander was born on 1978-04-06.
When was Erland Colliander born?
Erland Colliander was born on October 9, 1878, in Stockholm, Sweden.
When was Martha Colliander born?
Martha Colliander was born on April 24, 1888, in Stockholm, Sweden.
When was Helen Colliander born?
Helen Colliander was born on October 11, 2000, in Berkeley, California, USA.
When was Tito Colliander born?
Tito Colliander was born on February 10, 1904, in St. Petersburg, Russia.
What is the birth name of Tito Colliander?
Tito Colliander's birth name is Tito Fritiof Colliander.
When did Sven Colliander die?
Sven Colliander died in 1961.
When did Tito Colliander die?
Tito Colliander died on May 21, 1989, in Helsinki, Finland.
What has the author Tito Colliander written?
Tito Colliander has written: 'Med o ppna ha nder'
Trending Questions
How bad is it to do a foreclosure and a bankruptcy at the same time?
What is Plotinus' perspective on beauty and how does it differ from other philosophical views?
Is 8 pints and one cup bigger than 2 gallons?
What do payroll clerks get paid?
Why white discharge after taking primolut nor?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
What does it mean that an Iceberg has calved?
Should you use 10w 30 or 5w30 oil in a 95 Ford F 150 with the inline 6 cylinder?
RDY and NDA are?
What is .5 percent of a million dollars?
How does one go to the Half Dome?
Where is team magma in soul silver?
How do you report telemarketing calls to your do-not-call cell phone?
Is splenda and popcorn good for you?
Does an eagle eat a wolf?
What is the surface area and volume when the width is 9 cm and the height is 14 cm and the depth is 7 cm?
What is the meaning of paragraph by analogy?
Why is hair not digestible?
How do you say its a pleasure in Spanish?
How can I improve my technique in playing guitar barre chord shapes?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.