0
What else can I help you with?
Related Questions
When did Pierre Johanns die?
Pierre Johanns died in 1955.
When was Mike Johanns born?
Mike Johanns was born on June 18, 1950.
When was Johanns Dulcien born?
Johanns Dulcien was born on 1991-03-26.
What is Mike Johanns's birthday?
Mike Johanns was born on June 18, 1950.
When was Fred Johanns born?
Fred Johanns was born in 1943, in Jersey City, New Jersey, USA.
How old is Mike Johanns?
Mike Johanns is 61 years old (birthdate: June 18, 1950).
When did Fred Johanns die?
Fred Johanns died on April 6, 2010, in Jersey City, New Jersey, USA.
What is Nebraska Senator Mike Johanns' stance on the federal Defense Of Marriage Act?
Senator Johanns does not support the repeal of DOMA.
What is Johanns favorite color?
black
When was Pierre Quiroule born?
Pierre Quiroule was born in 1892.
When was Pierre Capretz born?
Pierre Daret was born in 1604.
When was Pierre Falcone born?
Pierre Falcone was born in 1954.
Trending Questions
Calculate the molarity of a H3PO4 solution of 6.66 in 555mL of solution?
What are treatments for splenic trauma?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
Does logh mean forgive in Gaelic?
What is the collect noun for tools?
Are phoenix university credits transferable?
Where is the Unitarian Universalist Church located?
How much solar energy reaches Earth?
What is a female monk called in the Chinese language?
Which theme can be found in both If and The Jungle Book by Rudyard Kipling?
Where is the habitat of Rhizomes?
How much are ballet point shoes at a dance school?
Is 0.323232 rational?
What did George Washington say?
What steps can use to protect yourself from cybercrime?
The three states of matter are?
Is the setting in England for James and the Giant Peach?
Was Australia called Australia in 1901?
Sleepover games for 18 year olds?
What is the denominator of fraction?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.