0
What else can I help you with?
Related Questions
What is Province of Nuoro's population?
Province of Nuoro's population is 161,444.
What is the area of Province of Nuoro?
The area of Province of Nuoro is 3,934 square kilometers.
When was Roman Catholic Diocese of Nuoro created?
Roman Catholic Diocese of Nuoro was created in 1787.
What is 40 N. latitude and 9 east longitude?
08036 Ortueri, Province of Nuoro, Italy.
What is the population of Nuoro?
Nuoro's population is 36,347.
What is the area of Nuoro?
The area of Nuoro is 192.27 square kilometers.
When did Roman Catholic Diocese of Nuoro end?
Roman Catholic Diocese of Nuoro ended in 1495.
What has the author Cesare Pirisi written?
Cesare Pirisi has written: 'Giornale di Barbagia' -- subject(s): Politics and government, Nuoro (Sardinia : Province), Economic conditions
When was Oulu Province created?
Oulu Province was created in 1775.
When was The Province created?
The Province was created in 1898.
When was Chiriquí Province created?
Chiriquí Province was created in 1849.
When was Baoruco Province created?
Baoruco Province was created in 1943.
Trending Questions
Where will the super bowl going to be played?
Who is responsible for interprovincial trade and communications in Canada?
What is the name first letter c?
What does conclusion transition mean?
What does an air bag do to the acceleration of the person as they land compared to hard ground and how does this change the net force on the person as they land compared to hard ground?
What is an affine connection?
What do you do if people start calling you a lesbian?
When was Anna Arina Marenko born?
Does Paul McCartney have a house in Jamaica?
When X-Ray photons collide with electrons?
What is 12 percent of 4000?
What are the two rivers in the middle east and what did they do for people?
What is The stage of the commander's decision cycle is facilitated by the commander's intent CCIRs also assist the JTF HQ in this role.?
How did the Catholic Bible get seven extra books?
What is the conflict story of alpheus and arethusa?
What are the people that do x rays?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
Which party rules in goa?
Where can you find a hotel that allows guests to check in at 18 years old?
What does velocity tell you that speed does not?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.